Methods of selecting T cell receptor V peptides for therapeutic use

Abstract

A method is disclosed to identify a T cell receptor (TCR) variable (V) peptide of use as a therapeutic agent in a subject. A method is also disclosed for monitoring the efficacy of a T Cell Receptor (TCR) V peptide for the treatment of a subject. In another embodiment, a method is disclosed for selecting a TCR V peptide of use in therapy for a subject having an autoimmune disease.

Claims

I claim: 1 . A method of identifying a T cell receptor (TCR) variable (V) peptide of use as a therapeutic agent in a subject affected with a disorder, comprising: a) screening TCR V beta peptides, TCR V alpha peptides, or both TCR V beta peptides and TCR V alpha peptides to select a TCR V peptide that produces altered expression of a cytokine elicited in response to the TCR V peptide by T cells from the subject as compared to a control subject; b) determining a regulatory activity of CD4+CD25+ T cells isolated from the subject elicited in response to the TCR V polypeptide; thereby identifying a TCR V peptide of use as a therapeutic agent. 2 . The method of claim 1 , wherein the disorder is an autoimmune disease. 3 . The method of claim 2 , wherein the autoimmune disease is multiple sclerosis, Rheumatoid arthritis, systemic lupus erythematosis, type I diabetes, non-obese diabetes, myasthenia gravis, Grave's disease, Hashimoto's thyroiditis, or psoriasis. 4 . The method of claim 3 , wherein the autoimmune disease is multiple sclerosis. 5 . The method of claim 1 , wherein the method comprises screening TCR V beta peptides. 6 . The method of claim 1 , wherein the method comprises screening TCR V alpha peptides. 7 . The method of claim 1 , wherein altered expression of the cytokine is indicated by at least a 50% higher expression of the cytokine by T cells from the subject elicited in response to the TCR V peptide as compared to expression of the cytokine by T cells from a control subject elicited in response to the TCR V peptide. 8 . The method of claim 1 , wherein altered expression of the cytokine is indicated by at least a 50% lower expression of the cytokine by T cells from the subject elicited in response to the TCR V peptide as compared to expression of the cytokine by T cells from a control subject elicited in response to the TCR V peptide. 9 . The method of claim 1 , wherein the cytokine is an anti-inflammatory cytokine. 10 . The method of claim 9 , wherein the anti-inflammatory cytokine is interleukin-10 (IL-10). 11 . The method of claim 9 , wherein the anti-inflammatory cytokine is interferon gamma (IFN-γ). 12 . The method of claim 1 , wherein expression of the cytokine is determined by an immunospot assay. 13 . The method of claim 1 , wherein the TCR V peptide is a CDR2 peptide. 14 . The method of claim 1 , wherein determining the regulatory activity of the CD4+CD25+ T cells comprises contacting CD4 + T cells with the TCR V peptide to produce regulatory CD4+CD25+ T cells; contacting the regulatory CD4+CD25+ T cells with CD4+CD25− indicator T cells; and determining the proliferation of the CD4+CD25− indicator T cells or the release of inflammatory cytokines by the CD4+CD25− indicator cells after stimulation of a T cell receptor on the CD4+CD25− indicator cells. 15 . The method of claim 14 , wherein the stimulation of the T cell receptor comprises contacting the CD4+CD25− indicator cells with an antibody that specifically binds CD3 and an antibody that specifically binds CD28 or contacting the CD4+CD25− cells with a specific antigen. 16 . The method of claim 14 , wherein a decrease in the proliferation of the CD4+CD25− indicator T cells as compared to a control indicates that the TCR V peptide elicits regulatory activity. 17 . A method of monitoring the efficacy of a T Cell Receptor (TCR) V peptide for the treatment of a subject, comprising: exposing CD4+ cells from the subject to the TCR V peptide; and determining a T cell regulatory activity of CD4+CD25+ T cells isolated from the subject, wherein induction of regulatory activity indicates the efficacy of the TCR V peptide for the treatment of the subject. 18 . The method of claim 17 , wherein the subject has an autoimmune disease. 19 . The method of claim 18 , wherein the autoimmune disease is multiple sclerosis, Rheumatoid arthritis, systemic lupus erythematosis, type I diabetes, non-obese diabetes, myasthenia gravis, Grave's disease, Hashimoto's thyroiditis, or psoriasis. 20 . The method of claim 19 , wherein the autoimmune disease is multiple sclerosis. 21 . The method of claim 18 , wherein the TCR V peptide is a TCR V beta peptide. 22 . The method of claim 18 , wherein the TCR V peptide is a TCR V alpha peptide. 23 . The method of claim 18 , wherein the TCR V peptide is a CDR2 peptide. 24 . The method of claim 18 , wherein determining the regulatory activity of the CD4+CD25+ T cells comprises contacting CD4 + T cells with the TCR V peptide to produce regulatory CD4+CD25+ T cells; contacting the regulatory CD4+CD25+ T cells with CD4+CD25− indicator T cells; and determining the proliferation of the CD4+CD25− indicator T cells or the release of inflammatory cytokines by the CD4+CD25− indicator cells after stimulation of a T cell receptor on the CD4+CD25− indicator cells. 25 . The method of claim 24 , wherein the stimulation of the T cell receptor comprises contacting the CD4+CD25− indicator cells with an antibody that specifically binds CD3 and an antibody that specifically binds CD28 or contacting the CD4+CD25− cells with a specific antigen. 26 . The method of claim 23 , wherein a decrease in the proliferation of the CD4+CD25− indicator T cells as compared to a control indicates that the TCR V peptide elicits regulatory activity. 27 . A method of selecting a therapy for a subject having an autoimmune disease, comprising: a) identifying a T Cell Receptor Variable (TCR V) gene expressed by target T cells in the subject by screening for expression of a TCR V genes by activated T cells from the subject; and determining expression of a cytokine elicited in response to one or more TCR V peptides corresponding to the TCR V gene by T cells from the subject, thereby identifying a TCR V gene expressed by target T cells; and b) identifying a TCR V peptides corresponding to the TCR V gene that elicit T cell regulatory activity by a T cell isolated from the subject; thereby selecting a therapy that targets T cells expressing the TCR V gene. 28 . The method of claim 27 , wherein the T cells are CD4+CD25+ T cells. 29 . The method of claim 27 , wherein the TCR V peptides are TCR V beta peptides. 30 . The method of claim 27 , wherein the TCR V peptides are TCR V alpha peptides. 31 . The method of claim 27 , wherein the TCR V peptides are CDR2 peptides. 32 . The method of claim 27 , wherein identifying the TCR V peptide corresponding to the TCR V gene that elicits T cell regulatory activity by a T cell isolated from the subject comprises contacting CD4 + T cells with the TCR V peptide to produce regulatory CD4+CD25+ T cells; contacting the regulatory CD4+CD25+ T cells with CD4+CD25− indicator T cells; and determining the proliferation of the CD4+CD25− indicator T cells or the release of inflammatory cytokines by the CD4+CD25− indicator cells after stimulation of a T cell receptor on the CD4+CD25− indicator cells. 33 . The method of claim 32 , wherein the stimulation of the T cell receptor comprises contacting the CD4+CD25− indicator cells with an antibody that specifically binds CD3 and an antibody that specifically binds CD28 or contacting the CD4+CD25− cells with a specific antigen. 34 . The method of claim 32 , wherein a decrease in the proliferation of the CD4+CD25− indicator T cells as compared to a control indicates that the TCR V peptide elicits regulatory activity. 35 . The method of claim 32 , wherein the subject has an autoimmune disease. 36 . The method of claim 35 , wherein the autoimmune disease is multiple sclerosis, Rheumatoid arthritis, systemic lupus erythematosis, type I diabetes, non-obese diabetes, myasthenia gravis, Grave's disease, Hashimoto's thyroiditis, or psoriasis. 37 . The method of claim 35 , wherein the autoimmune disease is multiple sclerosis.
PRIORITY CLAIM [0001] This is a continuation-in-part of U.S. application Ser. No. 09/853,830, filed May 10, 2001, which claims the benefit of U.S. Provisional Application No. 60/203,984, filed May 12, 2000, both of which are incorporated by reference herein in their entirety. This case also claims the benefit of U.S. Provisional Application No. 60/380,131, filed May 14, 2002, which is incorporated by reference in its entirety. STATEMENT OF GOVERNMENT SUPPORT [0002] This invention was made with United States government support pursuant to grant NS23221, from the National Institutes of Health and support from the Department of Veterans Affairs; the United States government has certain rights in the invention. FIELD [0003] This invention relates to the field of immunology and, more specifically, to methods of selecting T cell receptor peptides for therapeutic use. BACKGROUND [0004] Autoimmune diseases affect about 5% of the human population, often causing chronic, debilitating illnesses. Although all individuals have immune cells that potentially react with antigens present on their own tissues, these autoreactive cells are normally held in check by complex and currently poorly understood regulatory mechanisms. In individuals who develop autoimmune disease, these regulatory mechanisms are proposed to be somehow defective, which allows autoreactive cells to mount an immunological attack against host tissues. [0005] Animal models have aided in understanding the mechanisms underlying autoimmune diseases. For example, experimental allergic encephalomyelitis (EAE) is an autoimmune disease of the central nervous system that can be induced in mice and rats by immunization with myelin basic protein (MBP). Histologically and clinically, EAE resembles multiple sclerosis (MS) in humans. EAE is mediated by T cells having specificity for myelin antigens, such as MBP, as evidenced by the ability of MBP- or other myelin-reactive T cells to induce EAE when adoptively transferred to healthy hosts. Analysis of the antigen-binding receptor, or T cell receptor (TCR), expressed by MBP-reactive T cells has generally revealed that these T cells express a limited number of TCR V alpha (AV, α) and TCR V beta (BV, β) polypeptide chains. [0006] The TCR is a heterodimeric glycoprotein present on the surface of T cells. The TCR exists in two forms, one consisting of an alpha chain and a beta chain, the second consisting of a gamma chain and a delta chain. Each TCR polypeptide chain is encoded by a genetic locus containing multiple discontinuous gene segments. These include variable (V) region gene segments, joining (J) region gene segments and constant (C) region gene segments. Beta and delta chains contain an additional element termed the diversity (D) gene segment. The TCR gene segments become rearranged during T cell maturation to form VJ or VDJ genes, which are then expressed as polypeptide chains. There are at least 50 different human Vα (or AV), 57-70 Vβ (or BV), 3 Vδ (or GV) and 7Vγ (or DV) gene segments, which are categorized into various families, with members of a family sharing substantial nucleotide and amino acid sequence identity. [0007] EAE has successfully been prevented or treated by various methods that selectively target the TCR V genes present on encephalitogenic T cells. Such therapeutic methods include immunization with TCR V region peptides to induce an immune response against the autoreactive T cells, and administering anti-TCR V region antibodies to bind and either kill or inactivate the autoreactive T cells. Once the disease-associated TCR V genes are identified in humans, analogous immunotherapeutic methods that target T cells expressing these V genes are also expected to be effective. However, a need remains to provide an efficient and effective means to identify TCR V genes of use in therapeutic strategies. [0008] Human autoimmune diseases have proven to be more complex than experimental animal models, in part because there are numerous autoantigens implicated in human diseases, and human responses to different autoantigens depend on multiple genetic factors. In certain studies, T cells from individuals with autoimmune disease that react to proposed autoantigens have been demonstrated to express a limited subset of V genes. However, the relevance of these T cells to the disease is as yet unclear, because the particular antigen used in assessing T cell reactivity is not necessarily involved in the etiology of the disease in that individual. In certain studies, T cells obtained from the site of the pathology from individuals with autoimmune disease have been demonstrated to express a limited subset of V genes. Unfortunately, the currently available methods of identifying TCR V gene usage do not take into account the regulatory mechanisms that may be acting in a particular individual to control the activity of the relevant T cells. [0009] Thus, there exists a need for an improved method of identifying disease-associated T cells in individuals, including both autoreactive T cells and regulatory T cells. Once the identity of the disease-associated T cells is known, appropriate, individualized therapies can be selected to prevent or treat the disease. Thus, there also exists a need for assays to efficiently and effectively select therapeutic agents of use. SUMMARY [0010] A method is disclosed herein to identify a T cell receptor (TCR) variable (V) peptide of use as a therapeutic agent in a subject. The method includes screening TCR V beta peptides, TCR V alpha peptides, or both TCR V beta peptides and TCR V alpha peptides to select a TCR V peptide that produces altered expression of a cytokine elicited in response to the TCR V peptide by T cells from the subject, and determining a regulatory activity of CD4+CD25+ T cells isolated from the subject elicited in response to the TCR V polypeptide. In one embodiment, the subject has an autoimmune disease. In one embodiment, a method is also disclosed for monitoring the efficacy of a T Cell Receptor (TCR) V peptide for the treatment of a subject. The method includes exposing CD4+ cells from the subject to the TCR V peptide; and determining a T cell regulatory activity of CD4+CD25+ T cells isolated from the subject. [0011] In another embodiment, a method is disclosed that is of use for selecting a therapy for a subject having an autoimmune disease. The method includes identifying a T Cell Receptor Variable (TCR V) gene expressed by target T cells in the subject by determining expression of a TCR V gene by activated T cells from the individual; and determining expression of a cytokine elicited in response to one or more TCR V peptides corresponding to the TCR V gene by T cells from the individual, thereby identifying a TCR V gene expressed by target T cells. The method also includes identifying a TCR V peptide corresponding to the TCR V gene that elicits T cell regulatory activity by a T cell isolated from the subject. [0012] The foregoing and other features and advantages will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE FIGURES [0013] [0013]FIG. 1 is a bar graph showing cytokine production in response to BV CDR2 peptides. Solid bars represent mean frequencies per million PBMC±SEM of TCR BV specific IL-10 or IFN-γ-secreting cells (background subtracted) for 5 healthy controls. Superimposed gray bars represent mean frequencies for 3 MS patients (error bars not given for clarity). In some cases where mean frequency for MS donors is greater than HC (i.e. BV5S4A1T), the solid bar is obscured, but the mean frequency for HC can be discerned by locating the origin of the error bar. Designations: B=beta chain; V=variable region; BV1-25=family; S1-8=subfamily; Al-6=allele; N1-4=single nucleotide difference; T=tentative; O=orphon gene (located on different chromosome from TCR complex); P=pseudogene (contains a stop codon within the coding region). [0014] [0014]FIG. 2 is a bar graph showing cytokine production in response to AV CDR2 peptides. Solid bars represent mean frequencies per million PBMC±SEM of TCR AV specific IL-10 or IFN-γ-secreting cells (background subtracted) for 5 healthy controls. Superimposed gray bars represent mean frequencies for 2-3 MS patients (responses to only 15 AV peptides available in 1 patient). In some cases where mean frequency for MS donors is greater than HC (i.e. AV1S1), the solid bar is obscured, but the mean frequency for HC can be discerned by locating the origin of the error bar. Designations: A=beta chain; D=delta chain; V=variable region; AV1-32=family; S1-5=subfamily; A1-5=allele; N1-2=single nucleotide difference; T=tentative. [0015] [0015]FIG. 3 is a scattergram of the frequency of IL-10 secreting cells in response to TCR peptides. The frequencies are shown for BV5S2 and BV6S1A1N1T specific T cells (background subtracted) for MS patients and healthy controls (HC). Bars in each column represent mean±SEM for each group. Note significantly reduced frequencies in MS patients. [0016] [0016]FIG. 4 is a set of bar graphs showing the average IL-10 responses from subjects. FIG. 4A is a bar graph showing the average IL-10 responses in healthy controls compared to MS patients. The peptides were recognized significantly better (p<0.05) by HC than MS patients. FIG. 4B is a bar graph showing the average IL-10 responses in symptomatic RRMS patients compared to healthy controls. These data identify discriminatory peptides that differ between healthy controls (HC) and MS patients. The peptides were recognized better by two symptomatic RRMS patients than HC. Note significant difference in group means for each comparison. A third SPMS patient responded better than HC to BV25S1A1T and AV1S2A1N1T peptides only. [0017] [0017]FIG. 5 is a series of bar graphs showing detection of Treg activity in the blood from a healthy control and a TCR-specific T cell line, but not in blood from an MS patient. FIG. 5A is a bar graph of Treg activity from CD4+CD25+ T cells freshly sorted from the blood of a healthy control and mixed at the indicated ratios with autologous sorted CD4+CD25− T cells. These cells were stimulated with plate-bound anti-CD3/anti-CD28 mAb for 72 hours and assessed for proliferation. I 50 value (42%=0.72 ratio of CD4+CD25+ T cells:CD4+CD25− T cells) represents the percentage of CD4+CD25+Treg cells that induced 50% suppression of CD4+CD25− T cell response. Note that the CD4+CD25+ T cells alone (0:1 ratio) had very low proliferation to stimulation, but induced a dose-dependent inhibition of CD4+CD25-T cells. FIG. 5B is a bar graph of Treg activity from the same assay carried out on sorted T cell populations from an MS patient. Note full response of CD4+CD25+T cells alone to stimulation, and complete lack of inhibition of CD4+CD25− T cells at all cell mixtures (I 50 could not be determined). FIG. 5C is a bar graph of Treg activity from the same assay carried out using a CD4+CD25+ T cell line specific for single chain (AV23:BV6S1) TCR molecule from an MS donor previously vaccinated with TCR peptides to inhibit autologous CD4+CD25− cells. Note low response of the line to stimulation and a dose-dependent inhibition (I 50 =43%=0.75 ratio) of autologous CD4+CD25− indicator cells, similar to panel 5A. [0018] [0018]FIG. 6 is a graph demonstrating that peptide vaccination increases frequency of TCR Reactive T cells. Anti-TCR responses of an MS patient to monthly injections of a cocktail of the 3 indicated BV CDR2 peptides are shown. Response was assessed using the limiting dilution assay to determine the frequency of proliferating peptide-specific T cells for each individual peptide and for the cocktail. Note maximal response (frequency>47 cells/million PBMC) to all peptides beginning 4 weeks after the first injection of peptide cocktail that persisted through week 24 (four weeks after the last injection). [0019] [0019]FIG. 7 is a set of bar graphs showing Treg activity. FIG. 7A is a bar graph of MS-102 (IFA) PBMC Treg assay (I 50 not calculatable). FIG. 7B is a bar graph of MS-111 (peptide/IFA) peptide specific CD4+CD25+ T cell line Treg assay. FIG. 7C is a bar graph of MS-111 (peptide/IFA) PBMC Treg assay. [0020] [0020]FIG. 8 is a bar graph showing proliferation response of T cell lines to pooled TCR CDR2 peptides from an HC donor. Proliferation response of T cell lines from an HC donor to 3 peptide pools as follows: Pool #1, IL-10-inducing 8 peptides (AV15S1, BV10S1P, BV11S1A1T, BV12S1A1N1, BV12S2A2T, BV13S7, BV19S20 and BV21S3A1T), Pool #2, IFN-g-inducing 3 peptides (ADV6S1A1N1, BV12S2A1T and BV12S2A2T), Pool #3, Proliferative 6 peptides (AV1S1, AV2S2A2T, AV29S1A2T, BV5S2A1T, BV7S1A1N1T and BV8S1). Pool 1 was chosen to discriminate IL-10 responses between MS patients and HC, Pool 2, to discriminate IFN-γ responses between MS patients and HC, and Pool 3 to induce proliferation responses in HC as well as MS patients. Note the proliferation inducing ability of all three pools. [0021] [0021]FIG. 9 is a line graph showing that Treg-induced suppression is absent or reduced in MS patients versus age-matched healthy controls (HC). Values indicate % suppression at the 1:2 ratio of CD4+CD25− indicator cells:CD4+CD25+Treg cells obtained from MS and HC PBMC by bead sorting. Error bars indicate 2-6 repeat evaluations on indicated donors over a period of 1-12 months. [0022] [0022]FIG. 10 is a schematic diagram of an assay for Treg activity. [0023] [0023]FIG. 11 is a plot showing that Treg activity was detected in 11/12 TCR-reactive T cell lines but in 0/7 T cell lines reactive to non-TCR antigens or ConA (p<0.001). SEQUENCE LISTING [0024] The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. DETAILED DESCRIPTION [0025] I. Abbreviations APC antigen presenting cell CD cluster of differentiation CDR complementarity determining region Cpm counts per minute FACS fluorescence activated cell sorting IFN interferon IL interleukin HC healthy control MS multiple sclerosis PBMC peripheral blood mononuclear cells TCR T Cell Receptor Treg Regulatory T cell I 50 Inhibitory dose (50%) [0026] II. Terms [0027] Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). [0028] In order to facilitate review of the various embodiments of the invention, the following explanations of specific terms are provided: [0029] Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term mammal includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects. [0030] Antigen: A compound, composition, or substance that can stimulate the production of antibodies or a T cell response in an animal, including compositions that are injected or absorbed into an animal. An antigen reacts with the products of specific humoral or cellular immunity, including those induced by heterologous immunogens. The term “antigen” includes all related antigenic epitopes. [0031] Autoimmune disease: A disease in which the immune system produces an immune response (e.g. a B cell or a T cell response) against an antigen that is part of the normal host, with consequent injury to tissues. An autoantigen may be derived from a host cell, or may be derived from a commensal organism such as the microorganisms (known as commensal organisms) that normally colonise mucosal surfaces. [0032] Exemplary autoimmune diseases affecting mammals include rheumatoid arthritis (RA), juvenile oligoarthritis, collagen-induced arthritis, adjuvant-induced arthritis, Sjogren's syndrome, multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE), inflammatory bowel disease (e.g. Crohn's disease, ulceritive colitis), autoimmune gastric atrophy, pemphigus vulgaris, psoriasis, vitiligo, type I diabetes, non-obese diabetes, myasthenia gravis, Grave's disease, Hashimoto's thyroiditis, sclerosing cholangitis, sclerosing sialadenitis, systemic lupus erythematosis, autoimmune thrombocytopenia purpura, Goodpasture's syndrome, Addison's disease, systemic sclerosis, polymyositis, dermatomyositis, autoimmune hemolytic anemia pernicious anemia, and the like. CD4: Cluster of differentiation factor 4 polypeptide, a T cell surface protein that mediates interaction with the MHC class II molecule. A T cell that expresses CD4 is a “CD4+” T cell. [0033] CD4 + T cell mediated immunity: An immune response implemented by CD4 + T cells. [0034] CD25: Cluster of differentiation factor 25, the IL-2 receptor alpha chain. A T cell that expresses CD25 is a “CD25+” T cell. [0035] Cytokine: Proteins made by cells that affect the behavior of other cells, such as lymphocytes. In one embodiment, a cytokine is a chemokine, a molecule whose functions include the direction of cellular trafficking. A “regulatory cytokine” is intended to include Th2 cytokines such as interleukin-10 (IL-10), IL-4, IL-13, transforming growth factor beta (TGFβ), and other cytokines that are predominantly anti-inflammatory. Other cytokines that under appropriate conditions have anti-inflammatory effects include IL-5, TNF-α, IL-9, IFNP and IFN-γ. [0036] Immune response: A response of a cell of the immune system, such as a B cell, T cell, macrophage or polymorphonucleocyte, to a stimulus. An immune response can include any cell of the body involved in a host defense response for example, an epithelial cell that secretes interferon or a chemokine. An immune response includes, but is not limited to, an innate immune response or inflammation. In one embodiment, the immune response is specific for a particular antigen (an “antigen-specific immune response”). In one embodiment, an immune response is a T cell response, such as a Th1, Th2, or Th3 response. [0037] Immunoregulatory response: An immune response that regulates a subsequent inflammatory response or an immune response. An immunoregulatory response can be a suppressive response, which suppresses another immune response or inflammatory response. In one non-limiting example, a suppressive immune response involves immunoregulatory T cells (Treg) or T suppressor cells. In one non-limiting example, an immunoregulatory response involves the production of anti-inflammatory cytokines. An immunoregulatory response can be an activating response, which activates another immune response or inflammatory response. In one specific, non-limiting example, an activating immune response involves the up-regulation of cytokines. An assay for a “regulatory activity” of a T cell is a functional assay for immunoregulatory activity. Thus, not only must expression of a cytokine be determined, but it must be shown that the cytokine has an effect on a cell. In one specific, non-limiting example, a regulatory activity requires cell-to-cell contact. [0038] Isolated: An “isolated” biological component (such as a nucleic acid, peptide or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins that have been “isolated” thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids. [0039] Leukocyte: Cells in the blood, also termed “white cells,” that are involved in defending the body against infective organisms and foreign substances. Leukocytes are produced in the bone marrow. There are 5 main types of white blood cell, subdivided between 2 main groups: polymorphonuclear leukocytes (neutrophils, eosinophils, basophils) and mononuclear leukocytes (monocytes and lymphocytes). When an infection is present, the production of leukocytes increases. [0040] Lymphocytes: A type of white blood cell that is involved in the immune defenses of the body. There are two main types of lymphocytes: B cells and T cells. [0041] Lymphoproliferation: An increase in the production of lymphocytes. [0042] Mammal: This term includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects. [0043] Nucleic acid: A deoxyribonucleotide or ribonucleotide polymer in either single or double stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides. [0044] Oligonucleotide: A linear polynucleotide sequence of up to about 200 nucleotide bases in length, for example a polynucleotide (such as DNA or RNA) which is at least 6 nucleotides, for example at least 15, 50, 100 or even 200 nucleotides long. [0045] Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Similarly, an IRES (internal ribosomal entry site) is operably linked to a coding sequence if it allows entry of a ribosome, and subsequent translation of the coding sequence. Generally, operably linked DNA sequences are contiguous. Expression of two genes encoded by the same plasmid is regarded as operably linked if they are driven by one promoter and an IRES. [0046] Pharmaceutical agent or drug: A chemical compound, peptide or other composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject. [0047] Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this invention are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed. [0048] In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate. [0049] Polynucleotide: A linear nucleotide sequence, including sequences of greater than 100 nucleotide bases in length. [0050] Polypeptide: Any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation). A “peptide” is a chain of less than amino acids, such as a chain of about 10, 15, 20, 25, 30, 35, 40, 50, 75 or 100 amino acids in length. [0051] Preventing or treating a disease: “Preventing” a disease refers to inhibiting the full development of a disease, for example in a person who is known to have a predisposition to a disease such as an autoimmune disorder. An example of a person with a known predisposition is someone with a history of multiple sclerosis in the family, or who has been exposed to factors that predispose the subject to a condition, such as lupus or rheumatoid arthritis. “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition, such as the symptoms associated with organ transplant rejection. As used herein, the term “ameliorating,” with reference to an autoimmune pathology, refers to any observable beneficial effect of the treatment. The beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms in a susceptible mammal, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, a reduction in the number of relapses of the disease, a reduction in the number or activity (such as cytokine secretion) of pathogenic T cells at the site of pathology or in the circulation, an improvement in the overall health or well-being of the individual, or by other parameters well known in the art that are specific to the particular disease. Those skilled in the art can determine, based on knowledge of the expected course of the particular disease, whether there is a delayed onset of clinical symptoms. Those skilled in the art can also determine whether there is an amelioration of the clinical symptoms or reduction in the number or activity of pathogenic T cells following treatment as compared with before treatment or as compared to an untreated subject. [0052] Portion of a nucleic acid sequence: At least 10, 20, 30 or 40 contiguous nucleotides of the relevant sequence, such as a sequence encoding an antigen. In some instances it would be advantageous to use a portion consisting of 50 or more nucleotides. In one specific non-limiting example, when describing a portion of an TCR V polypeptide it may be advantageous to utilize a relevant sequence encoding at least 10, 20, 30, 40, 50 or 100 amino acids of the TCR V polypeptide. [0053] Promoter: A promoter is an array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. The promoter can be a constitutive or an inducible promoter. A specific, non-limiting example of a promoter is the HCMV IE promoter. [0054] Purified: The term purified does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified peptide preparation is one in which the peptide or protein is more enriched than the peptide or protein is in its natural environment within a cell. Preferably, a preparation is purified such that the protein or peptide represents at least 50% of the total peptide or protein content of the preparation. In several embodiments, a peptide is substantially purified if it is 85%, 90%, 95%, or 99% purified. [0055] Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Similarly, a recombinant protein is one encoded for by a recombinant nucleic acid molecule. [0056] Regulatory activity of a T Cell: A detectable property that correlates with Th2-type, anti-inflammatory T cell activity. The particular regulatory activity to detect in the method will depend on the type and sensitivity of the assay used, and can be chosen by one of skill in the art. In one embodiment, a regulatory activity is demonstrated by CD4+CD25+ T cells. In this embodiment, an assay can be used that determines the regulatory activity of a CD4+CD25+ T cell. In one specific, non-limiting example, CD4+CD25+ T cells isolated from a subject are contacted with a TCR V peptide of interest, and the proliferation of CD4+CD25− T cells isolated from the subject that are co-incubated with the CD4+CD25+ T cells is assessed (see the Examples below). In anther specific, non-limiting example, secretion of a cytokine is assessed. [0057] Subject: Living, multicellular vertebrate organisms, a category that includes both human and veterinary subjects for example, mammals, birds and primates. [0058] Therapeutically effective dose: A dose sufficient to have a therapeutic effect, for example to prevent advancement, or to cause regression of a disease, such as an autoimmune disease. A therapeutically effective dose can also be a dose which is capable of relieving symptoms caused by the disease, such as pain or swelling. [0059] T Cells and Immunoregulatory T Cells: T cells are a key cell type in the human cellular immune system, providing both function and biochemical control. T cells are classified based on which cell surface receptors and cytokines they express. The expression of cell surface receptors CD4 and/or CD8 are generally used to define two broad classes of T cells; these cell surface receptors are involved in recognizing antigens presented to the T cells by antigen presenting cells (APC). Certain mature T cells express only CD4 but not CD8 (termed CD4 + cells), while other mature T cells express CD8 but not CD4 (termed CD8 + cells). [0060] CD8 + cells recognize peptide antigens that are presented on MHC class I molecules. Upon activation by an APC (which involves binding of both a stimulatory antigen and a costimulatory ligand), a CD8 + T cell matures into a cytotoxic T cell, which has defined functions and characteristics. CD4 + T cells recognize antigens that are presented on MHC class II molecules. When activated by an APC, CD4 + T cells can differentiate into T helper (Th) cells. Th cells have been divided into subclasses based on their cytokine secretion profiles. Th1 cells secrete a specific set of cytokines, including interferon-γ (IFN-γ) and interleukin-12 (IL-12), interleukin-2 (IL-2), interferon-γ and lymphotoxin and activate the cellular immunity processes (such as macrophage activation and induction of IgG antibodies by B cells). Th2 cells secrete different cytokines (particularly IL-4, IL-5 and IL-10), and mediate humoral immunity and allergic reactions. [0061] An “immunoregulatory T cell” (Treg) is a CD4+ cell that inhibits proliferation of other cell populations in vitro. In one embodiment, an immunoregulatory T cell is a CD4+CD25+ T cell. Without being bound by theory, Treg cells are a product of normal thymic selection, and may arise from relatively high avidity interaction with self-peptide-MHC complexes. IL-10, and perhaps TGF-β, but not IL-4 appear to be crucial for the differentiation of Treg cells. Suppressive activity requires activation of Treg cells through their TCR, does not involve killing of responder cells, and is mediated in part through a contact dependent mechanism. The properties of CD4+CD25+ cells have recently been reviewed (see Baecher-Allan et al., J. Immunol. 167:1245-53, 2001). An assay for detecting T cell regulatory activity is disclosed herein. [0062] T Cell Receptor (TCR) and TCR Receptor Peptides: Membrane-bound proteins composed of two transmembrane chains that are found on T cells. The T cell receptor recognizes antigen peptides presented in the context of the Major Histocompatibility Complex (MHC) proteins. In the case of CD4 + T cells, the antigen peptides must be presented on Class II MHC, and in the case of CD8+ T cells, the antigen peptides must be presented on Class I MHC. The T cell antigen receptor consists of either an alpha/beta chain or a gamma/delta chain associated with the CD3 molecular complex. The two transmembrane chains consist of two domains, called a “variable” and a “constant” domain, and a short hinge that connects the two domains. The V domains include V-, D-, and J-immunoglobulin like elements in the β chanin and V- and J-like elements in the a chain. [0063] A “TCR V” peptide is a portion of the variable (V) region of the TCR itself, such as a peptide that includes about 10, 20, 30, 40 or about 50 consecutive amino acids of the V region of the TCR, or a variant thereof. A “variant” of a TCR peptide is a molecule substantially similar to either the entire peptide or a fragment thereof, such as about 75%, 80%, 90%, 95%, or 99% similar. In one embodiment, a variant includes an amino acid substitution, such as at least one conservative amino acid substitution. Conservative” amino acid substitutions include those listed below. Original Residue Conservative Substitutions Ala Ser; Gly Arg Lys Asn Gly, His Asp Glu Cys Ser Gln Asn Glu Asp Gly Ala; Pro His Asn; Gln Ile Leu, Val Leu Ile; Val Lys Arg; Gln; Glu Met Leu; Ile; Tyr Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu [0064] Variant peptides may be conveniently prepared by direct chemical synthesis or by molecular techniques well known to one of skill in the art. For example, amino acid sequence variants of a TCR V peptide can be prepare by mutations in the nucleic acid encoding the peptide. Such variants include, for example, deletions from, or insertions or substitutions of, residues within the amino acid sequence. However, a variant must not create complementary regions that provide secondary mRNA structure. Suitable variants are described in U.S. Pat. No. 5,614,12, which is incorporated herein by reference in its entirety. [0065] In one specific, non-limiting example, the TCR V peptide is a “TCR V beta (β) peptide. In another specific, non-limiting example, the TCR peptide corresponds to the VDJ region of the TCR β chain or the V region of the TCR V a chain. In another embodiment, the peptide corresponds to at least part of one of the three complementarity determining regions (CDR) of the TCR heterodimer, such as the second CDR (CDR2). TCR V peptides are described below in the Examples section, and are also described in U.S. Pat. No. 5,614,192; U.S. Pat. No. 5,776,459; U.S. patent application Ser. No. 09/853,830, all of which are incorporated herein by reference in their entirety. [0066] Transduced and Transformed: A virus or vector “transduces” a cell when it transfers nucleic acid into the cell. A cell is “transformed” by a nucleic acid transduced into the cell when the DNA becomes stably replicated by the cell, either by incorporation of the nucleic acid into the cellular genome, or by episomal replication. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration. [0067] Vector: In one embodiment a nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art. In one embodiment the term “vector” includes viral vectors, such as adenoviruses, adeno-associated viruses, vaccinia, and retroviral vectors. In one embodiment the term vector includes bacterial vectors. [0068] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. The term “comprises” means “includes.” All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. [0069] III. Method for Screening for TCR V Peptides [0070] A method is disclosed herein for identifying a T cell receptor (TCR) variable (V) peptide of use as a therapeutic agent in a subject. In one embodiment, the subject has an autoimmune disease. A method is provided herein to screen TCR alpha chain peptides, TCR beta chain peptides, or both TCR alpha and TCR beta chain peptides to select a TCR V peptide of use in inducing the activity of regulatory T cells (Treg). Thus, using the screening methods provided herein, one of skill in the art can select a TCR V peptide that induces maximal Treg activity for use in a subject having an autoimmune disorder. These TCR V peptides can be utilized to produce an increase in Treg cells in the subject, such that Treg cells can be detected as a component of the peripheral blood mononuclear cells. [0071] The method includes selecting a TCR V peptide that produces altered expression of a cytokine elicited in response to the TCR V peptide by T cells from the subject. The method also includes determining a regulatory activity of CD4 + T cells isolated from the subject elicited in response to the TCR V polypeptide. Generally, determining a regulatory activity is an assay that demonstrates the function of the cells. These assays can be performed simultaneously or sequentially, in any order. [0072] The T cells of use in the assay can be derived from any convenient T cell source in the subject, such as lymphatic tissue, spleen cells, blood, cerebrospinal fluid (CSF) or synovial fluid. The T cells can be enriched, if desired, by standard positive and negative selection methods (see below). If enriched, the T cell population should retain a sufficient number of antigen-presenting cells to present the TCR peptide to the regulatory T cells. A convenient source of T cells to use in a cytokine assay are peripheral blood mononuclear cells (PBMC), which can be readily prepared from blood by density gradient separation, by leukapheresis or by other standard procedures known in the art. [0073] TCR peptides are well known in the art (see for example, U.S. Pat. No. 5,614,192, U.S. Pat. No. 5,776,459; and U.S. patent application Ser. No. 09/853,830, all of which are incorporated by reference herein in their entirety). The TCR peptide can contain the complete V chain, or any immunogenic portion of the V region that is characteristic of the particular TCR V gene or gene family of interest. Such a peptide can have a sequence that is identical to that of the naturally occurring V chain. In one embodiment, a TCR V peptide includes one or more substitutions, such as a TCR V peptide that contains 1, 2 or several substitutions that do not alter its specificity for the TCR V gene or gene family of interest. [0074] Useful TCR V peptides will generally be from about 8 to about 100 amino acids in length, such as from about 10 to about 50 amino acids, including from about 15 to about 30 amino acids. TCR V peptides having any amino acids sequence of interest can be prepared by methods known in the art, including chemical synthesis and recombinant methods. [0075] The CDR2 region, which corresponds to amino acids 38-58 of alpha (A) V and beta (B) V chains, is a region that is characteristic of each TCR V chain. The amino acid sequences of peptides corresponding to amino acids 38-58 of each of the 116 known AV and BV chains are shown in Tables 2 and 3. Within a given family (e.g. BV6) or subfamily (e.g. BV6S1) of V chains, amino acids 38-58 generally differ at only one or several positions. Accordingly, if desired, a consensus CDR2 peptide can be prepared, which does not necessarily have the exact sequence of any naturally occurring V chain, but which stimulates T cells that are reactive against all members of the family or subfamily. [0076] Appropriate TCR V peptides to use in the methods disclosed herein can be determined by those skilled in the art. The immunogenicity of a given peptide can be predicted using well-known algorithms that predict T cell epitopes (see, for example, Savoie et al., Pac. Symp. Biocomput. 1999:182-189, 1999; Cochlovius et al., J. Immunol. 165:4731-4741, 2000). Both the immunogenicity and the specificity of a given peptide can be confirmed by standard immunological assays that measure in vivo or in vitro T cell responses (e.g. T cell proliferation assays, delayed type hypersensitivity assays, ELISA assays, ELISPOT assays and the like). [0077] In one specific, non-limiting example, T cells from the subject are contacted with a TCR V peptide of interest and the expression of a cytokine is detected. A variety of methods can be used to detect and quantitate cytokine expression by T cells. For example, an immunospot assay, such as the enzyme-linked immunospot or “ELISPOT” assay, can be used. The immunospot assay is a highly sensitive and quantitative assay for detecting cytokine secretion at the single cell level. Immunospot methods and applications are well known in the art and are described, for example in Czerkinsky et al., J. Immunol. Methods 110:29-36, 1988; Olsson et al. J. Clin. Invest. 86:981-985, 1990; and EP 957359. [0078] In general, the immunospot assay uses microtiter plates containing membranes that are precoated with a capture agent, such as an anti-cytokine antibody, specific for the cytokine to be detected. T cells of interest are plated together with a test immunogen, which in the invention method is a TCR V peptide. The T cells that respond to the immunogen secrete various cytokines. As the cytokine of interest is locally released by the T cells, it is captured by the membrane-bound antibody. After a suitable period of time the cell culture is terminated, the T cells are removed and the plate-bound cytokine is visualized by an appropriate detection system. Each cytokine-secreting T cell will ideally be represented as a detectable spot. The number of spots, and thus the number of T cells secreting the particular cytokine of interest, can be counted manually (e.g. by visualization by light microscopy) or by using an automated scanning system (e.g. an Immunospot Reader from Cellular Technology Ltd.). Examples I and II describe the use of an ELISPOT assay to quantitate and compare the number of regulatory T cells that secrete IL-10 (and/or IFN-γ) in response to different TCR V peptides in different individuals. [0079] Variations of the standard immunospot assay are well known in the art and can be used to detect cytokine secretion in the methods of the invention. For example, U.S. Pat. No. 6,218,132 describes a modified immunospot assay in which antigen-responsive T cells are allowed to proliferate in response to stimulation with the immunogen before detection of the cytokine of interest. This method, although more time-consuming, can be used to increase the sensitivity of the assay for detecting T cells present at a low frequency in the starting population. [0080] U.S. Pat. No. 5,939,281 describes an improved immunospot assay that uses a hydrophobic membrane instead of the conventional nitrocellulose membrane, to bind the cytokine capture reagent. This variation can be used to reduce the nonspecific background and increase the sensitivity of the assay. Other modifications to the standard immunospot assay that increase the speed of processing multiple samples, decrease the amount of reagents and T cells needed in the assay, or increase the sensitivity or reliability of the assay, are contemplated herein and can be determined by those skilled in the art. [0081] Antibodies suitable for use in immunospot assays, which are specific for secreted cytokines, as well as detection reagents and automated detection systems, are well known in the art and generally are commercially available. Appropriate detection reagents are also well known in the art and commercially available, and include, for example, secondary antibodies conjugated to fluorochromes, colored beads, and enzymes whose substrates can be converted to colored products (e.g., horseradish peroxidase and alkaline phosphatase). Other suitable detection reagents include secondary agents conjugated to ligands (e.g. biotin) that can be detected with a tertiary reagent (e.g. streptaviden) that is detectably labeled as above. [0082] Other methods for detecting and quantifying cytokine expression by T cells are well known in the art, and can be used as an alternative to immunospot assays in the methods of the invention. Such methods include the ELISA assay, which can be used to measure the amount of cytokine secreted by T cells into a supernatant (see, for example, Vandenbark et al., Nature Med. 2:1109-1115, 1996). Alternatively, the expression of cytokine mRNA can be determined by standard immunological methods, which include RT-PCR and in-situ hybridization. [0083] In one embodiment, the assay for expression of a cytokine involves an initial comparison between cytokine expression in response to a TCR V peptide in a test subject and a normal value for the same regulatory activity. The normal value can be a value obtained from a single healthy control individual, or can be an average of values obtained from a number of healthy control individuals. Suitable healthy control individuals can be identified by one of skill in the art, but generally will be appropriately matched for age, gender and other variables that can affect immunological activity. In one specific, non-limiting example, the control is one or more individuals of the same relative age and sex, but these individuals do not have an autoimmune disease. The normal value for cytokine expression can be determined at the same time, prior to or after assaying for cytokine expression in the test individual. [0084] As used herein, the term “low” or “reduced” or “decreased” with respect to cytokine expression refers to an activity that is significantly reduced in a test individual compared to the normal value for that activity. The extent of reduction required for significance will vary depending on the sensitivity and reproducibility of the method, but will generally be at least 25% lower than a normal value obtained for the same activity or response, such as at least 40%, 50%, 70%, 80% or 90% lower than the normal value. The term “low” also includes a complete absence of detectable activity, as evidenced by a background level of activity. Thus, in one embodiment, a TCR V beta peptide is identified that induces reduced expression of a cytokine in a subject with an autoimmune disorder as compared to a control. [0085] As used herein, the term “high” or “increased” with respect to cytokine expression refers to an activity that is significantly increased in a test individual compared to the normal value for that activity. The extent of increase required for significance will vary depending on the sensitivity and reproducibility of the method, but will generally be at least 25% higher than a normal value obtained for the same activity or response, such as at least 40%, 50%, 70%, 80% or 90% higher than the normal value. Thus, in one embodiment, a TCR V beta peptide is identified that induces increased expression of a cytokine in a subject with an autoimmune disorder as compared to a control. [0086] The method further includes an assay to identify a TCR V peptide that induces regulatory T cell (Treg) activity in T cell isolated from the subject. Treg activity can be assayed by any means known to one of skill in the art. Generally, an assay for Treg activity is an assay that demonstrates a function of the T cells. In one specific, non-limiting example, CD4 + T cells are isolated from a subject, and used to assay Treg activity. [0087] Method for isolated CD4+, CD4+CD25+ T cells, CD4+CD25− T cells, or other populations of T cells, are well known in the art. Typically, labeled antibodies specifically directed to the marker are used to identify the cell population. The antibodies can be conjugated to other compounds including, but not limited to, enzymes, magnetic beads, colloidal magnetic beads, haptens, fluorochromes, metal compounds, radioactive compounds or drugs. The enzymes that can be conjugated to the antibodies include, but are not limited to, alkaline phosphatase, peroxidase, urease and β-galactosidase. The fluorochromes that can be conjugated to the antibodies include, but are not limited to, fluorescein isothiocyanate, tetramethylrhodamine isothiocyanate, phycoerythrin, allophycocyanins and Texas Red. For additional fluorochromes that can be conjugated to antibodies see Haugland, R. P., Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals (1992-1994). The metal compounds that can be conjugated to the antibodies include, but are not limited to, ferritin, colloidal gold, and particularly, colloidal superparamagnetic beads. The haptens that can be conjugated to the antibodies include, but are not limited to, biotin, digoxigenin, oxazalone, and nitrophenol. The radioactive compounds that can be conjugated or incorporated into the antibodies are known to the art, and include but are not limited to technetium 99m ( 99 Tc), 125 I and amino acids comprising any radionuclides, including, but not limited to, 14 C, 3 H and 35 S. [0088] Fluorescence activated cell sorting (FACS) can be used to sort cells that express CD4, CD25, or both CD4 and CD25, by contacting the cells with an appropriately labeled antibody (e.g., see Example 12). However, other techniques of differing efficacy may be employed to purify and isolate desired populations of cells. The separation techniques employed should maximize the retention of viability of the fraction of the cells to be collected. The particular technique employed will, of course, depend upon the efficiency of separation, cytotoxicity of the method, the ease and speed of separation, and what equipment and/or technical skill is required. [0089] Separation procedures may include magnetic separation, using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents, either joined to a monoclonal antibody or used in conjunction with complement, and “panning,” which utilizes a monoclonal antibody attached to a solid matrix, or another convenient technique. Antibodies attached to magnetic beads and other solid matrices, such as agarose beads, polystyrene beads, hollow fiber membranes and plastic petri dishes, allow for direct separation. Cells that are bound by the antibody can be removed from the cell suspension by simply physically separating the solid support from the cell suspension. The exact conditions and duration of incubation of the cells with the solid phase-linked antibodies will depend upon several factors specific to the system employed. The selection of appropriate conditions, however, is well within the skill in the art. [0090] The unbound cells then can be eluted or washed away with physiologic buffer after sufficient time has been allowed for the cells expressing a marker of interest (e.g. CD4 and/or) to bind to the solid-phase linked antibodies. The bound cells are then separated from the solid phase by any appropriate method, depending mainly upon the nature of the solid phase and the antibody employed. [0091] Antibodies may be conjugated to biotin, which then can be removed with avidin or streptavidin bound to a support, or fluorochromes, which can be used with a fluorescence activated cell sorter (FACS), to enable cell separation, as known in the art. [0092] In one embodiment, CD4 + T cells are contacted with the TCR V peptide of interest to produce regulatory CD4+CD25+ T cells. The regulatory CD4+CD25+ are then contacted with CD4+CD25− responder cells. Thus, in one specific, non-limiting example, the assay for Treg activity requires cell-to cell-contact. In one embodiment, the CD4+CD25− cells are isolated from the same subject as the CD4+CD25+cells. In another embodiment, the CD4+CD25− cells are isolated from a different subject than CD4+CD25+cells. These cells are further contacted with an agent that induces proliferation. In one embodiment, the agent that induces proliferation activates the T cell through the T cell receptor. In one specific, non-limiting example the agent that induces proliferation is an antibody that specifically binds CD3 and an antibody that specifically binds CD28. In another specific non-limiting example, the agent that induces proliferation is a specific antigen. In yet another specific non-limiting example, the agent that induces proliferation is concavalin A (ConA). [0093] Proliferation is then assessed. One of skill in the art can readily identify suitable assays for proliferation. These assays include, but are not limited to, assays for 3 H-thymidine uptake, assays for bromodeoxyuridine uptake, and assays determining cell number. In one embodiment, an assay to detect cytokine release is utilized. Thus, a functional assay is performed. [0094] In one embodiment, Treg activity is indicated by reduced proliferation of CD4+CD25− responder cells in the presence of graded doses of CD4+CD25+ T cells, when stimulated with agents that induce proliferation as compared to control CD4+CD25− T cells that exhibit full proliferation response. In one specific, non-limiting example, a dose response curve is generated. Typically, the CD4+CD25+ cells do not proliferate well to the same stimulus, although these T cells may become activated to exert Treg activity by anti-CD3/CD28 or specific antigens such as TCR peptides. [0095] Changes in T cell regulatory activity in a single individual can be monitored over time to determine development or progression of an autoimmune disease, to monitor the efficacy of a therapy in restoring normal regulatory activity, or to determine an appropriate time to initiate, stop or readminister a therapy to boost regulatory activity. In performing such comparative assays, T cell samples obtained at various times can be frozen, and multiple assays performed simultaneously to minimize experimental variables. Assays can also be repeated several times and values averaged to increase the significance of observed differences. [0096] In one embodiment, the T Cell Receptor Variable (TCR V) gene usage by target T cells in the subject is assayed. Thus, the expression of a TCR V genes by activated T cells from the subject is determined, and a TCR that is preferentially expressed is identified. [0097] Without being bound by theory, one component of the mechanism underlying autoimmune disease is unregulated expansion of autoreactive T cells. These T cells have escaped normal regulation by V-specific regulatory T cells, and will preferentially express a corresponding V gene or limited set of V genes. [0098] As used herein, the term “preferentially expressed” indicates that the particular TCR gene is expressed at a significantly higher level among activated T cells in an individual than among unselected T cells from the same individual. The term “unselected T cells” encompasses any T cell population that has not been preselected for activated T cells, or which is not expected to be enriched (in comparison with PBMCs) for activated T cells. Exemplary populations of unselected T cells include, for example, peripheral blood mononuclear cells and CD4+ enriched blood cells. The level of enhanced TCR V gene expression required for significance, and thus for “preferential expression,” will vary depending on the sensitivity and reproducibility of the method, but will generally be at least a 20% increase, such as a 30%, 40%, 50%, 75%, 100% or greater increase in expression in the activated population than in the unselected T cell population. [0099] Activated T cells are CD4 + T cells that have undergone characteristic phenotypic and functional changes as a result of interacting with antigen presented in the context of class II MHC. Such phenotypic and functional changes can include, for example, expression of activation surface markers, secretion of Th1 cytokines, and proliferation. [0100] Activation surface markers include CD25 (which is the IL-2 receptor) CD 134 (OX-40), which is a cell surface glycoprotein in the tumor necrosis factor receptor family, as well as CD30, CD27, HLA-DR, and CD69. The structural and functional properties of T cell activation surface markers, as well as reagents suitable for detecting such markers, are well known in the art (see, for example, Barclay et al., “The Leucocyte Antigen FactsBook,” Academic Press, San Diego, Calif. (1993)). [0101] Activated T cells can further express surface marker profiles characteristic of memory T cells, which include, for example, expression of CD45RO+ and lack of expression of CD45RA. Therefore, in one embodiment, the method in practiced by determining TCR V gene expression among activated, memory T cells. [0102] Secreted cytokines that are characteristic of activated CD4 + T cells include, for example, interleukin-2 (IL-2), IL-4, IL-5, and γ-interferon (IFN-γ). The structural and functional properties of various cytokines, as well as reagents suitable for detecting cytokine expression and secretion, are well known in the art (see, for example, Thomson, ed., “The Cytokine Handbook,” 2 nd ed., Academic Press Ltd., San Diego, Calif. (1994)). [0103] A population of cells that contains activated T cells can be obtained from a variety of sources, including the peripheral blood, lymph, and the site of the pathology. The peripheral blood is generally the most convenient source of cells. However, appropriate pathological sites include the CNS (and particularly the cerebrospinal fluid) for multiple sclerosis and other autoimmune neurological disorders; the synovial fluid or synovial membrane for rheumatoid arthritis and other autoimmune arthritic disorders; and skin lesions for psoriasis, pemphigus vulgaris and other autoimmune skin disorders, any of which can be readily obtained from the individual. As available, biopsy samples of other affected tissues can be used as the source of T cells, such as intestinal tissues for autoimmune gastric and bowel disorders, thyroid for autoimmune thyroid diseases, pancreatic tissue for diabetes, and the like. [0104] The cell population need not be pure, or even highly enriched for activated T cells, so long as the method allows for a comparison of TCR gene expression by activated and unselected T cells. For example, by FACS analysis the expression of both an activation surface marker and a V chain polypeptide can be detected simultaneously, without enrichment for activated T cells, and the number of activated and non-activated (or total) T cells expressing the V chain compared. [0105] Depending on the assay method, it may be desirable to start with a cell population that is partially enriched, or highly enriched, for activated T cells. Methods for enriching for desired T cell types are well known in the art, and include positive selection for the desired cells, negative selection to remove undesired cells, and combinations of both methods. [0106] Enrichment methods are conveniently performed by first contacting the cell population with a binding agent specific for a particular T cell surface activation marker or combination of markers. Appropriate binding agents include polyclonal and monoclonal antibodies, which can be labeled with a detectable moiety, such as a fluorescent or magnetic moiety, or with biotin or other ligand. If desired, the T cells can be further contacted with a labeled secondary binding agent specific for the primary binding agent. The bound cells can then be detected, and either collected or discarded, using a method appropriate for the particular binding agent, such as a fluorescence activated cell sorter (FACS), an immunomagnetic cell separator, or an affinity column (e.g. an avidin column or a Protein G column). Other methods of enriching cells by positive and negative selection are well known in the art. [0107] Analogous methods have recently been developed for enriching for cells that secrete activation cytokines. In such methods a bivalent binding agent (e.g. a bivalent antibody) with specificity for both the secreted molecule and a cell surface molecule are allowed to contact the T cells. The secreted molecule, now relocated to the affinity matrix, is then contacted with a binding agent and bound cells sorted or separate by standard methods (see, for example, WO 99/58977 and Brosterhaus et al., Eur. J. Immunol., 29:4053-4059, 1999). [0108] TCR V gene expression by the selected or unselected T cell population can be determined by a variety of methods. For example, such methods can be based on detection and quantification of expressed TCR V polypeptide chains, TCR V gene transcripts, or rearranged V genes. [0109] Detection and quantification of V polypeptide expression can be practiced using agents that specifically bind particular V polypeptides, such as anti-V chain antibodies. Antibodies specific for a variety of Vα, Vβ, Vδ, and Vγ chains are available in the art (see, for example, Kay et al., Leuk. Lymphoma 33:127-133, 1999; Mancia et al., Scand. J. Immunol. 48:443-449, 1998). Alternatively, suitable polyclonal or monoclonal antibodies can be prepared by standard methods (see, for example, Harlow and Lane, Antibodies: A laboratory manual (Cold Spring Harbor Laboratory Press 1988); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (2001)), starting from a V chain peptide. [0110] Methods of detecting V polypeptide expression can be practiced using either whole cells or cell extracts. For example, whole cells can be contacted with appropriate detectably labeled antibodies and/or detectably labeled secondary antibodies. Cells that specifically bind the particular anti-V antibody are then detected and quantified by standard methods appropriate for the particular detectable label, such as FACS or immunofluorescence microscopy for fluorescently labeled molecules, scintillation counting for radioactively labeled molecules, and the like. Alternatively, cell extracts can be contacted with appropriate anti-V antibodies, and V polypeptide expression analyzed using standard methods, such as immunoprecipitation, immunoblotting or ELISA (see, for example, Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (2001)). [0111] Methods for detecting and quantifying TCR V gene transcripts or rearranged V genes generally involve specific hybridization of nucleic acid probes or primers to mRNA, cDNA, or genomic DNA, as appropriate, from the T cells of interest. The nucleotide sequences of Vα, Vβ, Vδ, and Vγ genes are well known in the art (see, for example, Genevee et al., Eur. J. Immunol. 22:1261-1269, 1992; Arden et al., Immunogenetics 42:455-500, 1995; Choi et al., Proc. Natl. Acad. Sci. USA 86:8941-8945, 1989; Concannon et al., Proc. Natl. Acad. Sci. USA 83:6598-6602, 1986; Kimura et al., Eur. J. Immunol. 17:375-383, 1987; Robinson, J. Immunol. 146:4392-4397, 1991; and the EMBL alignment database under alignment accession number DS23485). Therefore, the skilled person can readily prepare probes and primers specific for any TCR V gene of interest, appropriate for the particular detection method. [0112] Exemplary detection methods include, for example, reverse-transcriptase polymerase chain reaction (RT-PCR), Northern blots, RNase protection assays, in situ hybridization, and the like. Detection methods can conveniently employ radiolabeled or fluorescently labeled nucleotides, such that the amount of hybridization or amount of amplified product can be detected by a commercially available phosphorimaging apparatus. Suitable methods for detecting and quantitating mRNA expression are described, for example, in Ausubel et al., supra (2001) and other standard molecular biology manuals. [0113] Automated assays for simultaneously detecting and quantitating expression of a plurality of genes are also well known in the art, and are contemplated herein for determining V gene expression. For example, nucleic acid molecules specific for all or a particular subset of V genes can be attached to a solid support, such as a plate, slide, chip or bead, which can then be contacted with the appropriate T cells, T cell extracts, or T cell nucleic acid molecules, under suitable hybridization conditions, and processed automatically by standard methods. Likewise, immunological assays for simultaneously detecting expression of a plurality of polypeptides are well known in the art. Such methods generally involve the use of a plurality of different antibodies bound to a solid support, and binding can be detected by automated detection systems. [0114] Thus, in one embodiment, a preferentially expressed TCR V gene is identified, and TCR V peptides corresponding to the TCR V gene are selected. TCR V peptides corresponding to the preferentially expressed TCR V gene are then used to in a assay of the T cells of the subject of interest, such as a functional assay. The TCR V peptides corresponding to the preferentially expressed V gene are used to assay the expression of a cytokine elicited in response to one or more TCR V peptides, and are used to determine if the TCR V peptides induce Treg activity. Thus, using the methods disclosed herein, the TCR V peptides that are not recognized well in a subject with an autoimmune disorder, or that are recognized well but can be amplified by vaccination, are identified. [0115] The methods disclosed herein are illustrated by the following non-limiting Examples. EXAMPLES Example 1 Material and Methods [0116] Patients. Study participants included MS patients (ages 24-74) with definite relapsing-remitting or progressive MS, and healthy controls (HC, ages 23-55). MS patients had diagnosed MS for 2-30 years, and were currently not receiving Avonex™, Betaseron™, Copaxone™, or corticosteroids. Blood samples were obtained from the MS clinic after obtaining informed consent. [0117] TCR V gene expression. Peripheral blood mononuclear cells (PBMCs) were obtained and enriched for CD4 + T cells by removal of B cells, monocytes, NK cells and CD8+ T cells using antibody-coated magnetic beads. These cells were then stained with fluorescent mAb specific for CD4, activation (CD25), and naive (CD45RA) T cell markers. CD4+cells were gated and sorted by FACS to obtain activated memory T cells (CD25+, CD45RA−), as well as non-activated naive T cells (CD25−, CD45RA+). mRNA was prepared from the CD4+starting population, activated memory cells, and resting naive T cells, and evaluated for V gene expression by RT-PCR, essentially as described in Chou et al., J. Immunol. 152:2520-2529, 1994, using BV gene specific primers. [0118] Briefly, total RNA was isolated from fresh pelleted cells using the Stratagene RNA Isolation Kit (Stratagene, La Jolla, Calif.). cDNA was synthesized in a 20 μl volume using Superscript II reverse transcriptase (Life Technologies, Rockville, Md.) and an oligo(dT)12-18primer (Life Technologies, Rockville, Md.) following the manufacturer's recommendations. For amplification of TCRBV cDNA, a panel of 26 BV and a single BC primer was used. A portion of the BC primer was labeled (either 2 to 3% was radioactively labeled with 32 P-ATP, or 50% was end labeled at the 5′ end with the fluorochrome, Cy3 (Amersham Pharmacia Biotech, Piscataway, N.J.). As a positive control for the reaction, two BC primers (forward and reverse) were used, and the reverse primer was labeled as above. The cDNA from 1500 to 2000 T cells was used in each 15 μl reaction, along with 0.3 μl of each primer, 0.5U Taq DNA polymerase (Promega, Madison, Wis.), 50 mM KCl, 10 mM Tris-HCl (pH 9), 0.1% Triton X-100, 0.2 mM dNTPs, and 2 mM MgCl2. Amplification was carried out for 24-26 cycles (94.5 C×30 seconds, 60 C×1 minute, 72C×1 minute), followed by a final 5 minutes extension at 72C. All PCR reactions were performed in a Perkin Elmer GeneAmp 9600 thermocycler (Perkin-Elmer, Norfolk, Conn.). [0119] For the amplification of TCRAV cDNA, a panel of 30 AV primers and a AC primer were used (the AC primer was partially labeled as above). As a positive control for the reactions, two AC primers (forward and reverse) were used, one labeled as above. PCR conditions were as described above. Following amplification, 10 μl of each reaction was loaded on a 6% polyacrylamide gel and run at 250V for 22 minutes. If the DNA was radioactively labeled, the gel was dried for one hour, exposed to a phosphor screen for 30 minutes to hour, and analyzed by phosphor imaging (BioRad Molecular Imager FX, BioRad, Hercules, Calif.). If the DNA was fluorescently labeled, the gel was directly imaged on a fluorescent imager (BioRad Molecular Imager FX, BioRad, Hercules, Calif.). In either case, the PCR products of the correct size were quantitated by measuring phosphor or fluorescent signal intensity, and the background subtracted using an adjacent region below the bands. [0120] Antigens. Antigens used in the ELISPOT assay included ConA (2 μg/ml) and synthetic TCR peptides (25 μg/ml), including 116 known AV and BV gene products. [0121] T cell frequency. To determine antigen-specific T cell frequency by ELISPOT, blood mononuclear cells were separated by Ficoll density gradient centrifugation, resuspended in 2% human AB serum, and aliquotted at 0.5 and 0.25 million cells in triplicate wells of nitrocellulose-coated microtiter plates (Resolution Technologies) pretreated with anti-IFN-γ (Mabtech, Sweden) or anti-IL-10 (PharMingen, San Diego, Calif.) mAb. Peptides, ConA, and medium were added and the plates incubated at 37C for 24 hours (IFN-γ) or 48 hours (IL-10). Biotin-labeled secondary mAb for each cytokine was added, followed by streptavidin-alkaline phosphatase (Dako Corp., Carpinteria, Calif.) and substrate (BCIP/NBT phosphatase substrate, KPL, Gaithersburg, Md.) to develop optimal blue staining. Cytokine spots were quantified using an AID Immunospot Analyzer (AID, Cleveland, Ohio) equipped with a high resolution lens camera and analytical software designed for use with the AID system. Mean spots/well were calculated for each Ag, and net counts established after subtraction of background (no Ag). The frequency of Ag-specific spot-forming cells per million PBMC was determined from the average net response observed at two different cell concentrations. The mean net frequency+SEM was calculated for MS patients and HC, and differences compared by Student's t test for significance (p<0.05). [0122] Preparation of ELISPOT plates. Four flat bottom 96 well plates with nitrocellulose membranes were coated overnight with 4 μg/ml mouse anti-IL-10 monoclonal antibodies (Pharmingen), and an additional 4 plates were coated with 10 μg/ml mouse anti-human INF((Mabtech). Two hours before addition of peptides, plates were washed 3× with sterile PBS, pH 7.2, and blocked for one hour at room temperature with 10% FBS in sterile PBS. [0123] Blood processing. Twelve tubes of blood (approximately 120 ml) were collected from healthy controls and MS patients. The blood was immediately separated over a Ficoll gradient by centrifugation for 25 minutes at 2100 rpm at 25 degrees. Peripheral blood mononuclear cells (PBMC) so obtained were washed 3×with cold RPMI and resuspended to 10×10 6 cells per ml. [0124] TCR peptide screens. Sterile stocks containing 1 mg/ml peptide were aliquotted among 4 sterile 96 well polypropylene blocks. Blocks were kept refrigerated for up to one month. Precoated and blocked ELIPSOT plates were washed with 1× with blocking solution and 100 μl of stimulation medium was added (5% fetal bovine serum/1% human AB serum/2 mM pyruvate, 2 mM glutamate, and 50 μg/ml penicillin/streptomycin). 10 μl of each peptide was added per well in triplicate wells. The sequence of each Vα (AV) peptide is shown in Table 2, and the sequence of each Vβ (BV) peptide is shown in Table 2. Negative control wells contained RPMI, positive control wells contained 2 μg/ml final concentration ConA. To each well human PBMC were added at a density of 2.5×10 5 cells per well in a total of 8 plates (200×10 6 cells per well). Plates were incubated for 24 hours for INF-γ ELISPOTs and for 48 hours for IL-10 ELISPOTs. TABLE 1 Name Amino Acid Sequence SEQ ID NO: AV1S1 YPGQHLQLLLKYFSGDPLVKG 1 AV1S2A1N1T YPNQGLQLLLKYTSAATLVKG 2 AV1S2A4T YPNQGLQLLLKYTTGATLVKG 3 AV1S2A5T YPNQGLQLLLKYTSAATLVKG 4 AV1S3A1T YPNQGLQLLLKYLSGSTLVES 5 AV1S3A2T YPNQGLQLLLKYLSGSTLVKG 6 AV1S4A1N1T SPGQGLQLLLKYFSGDTLVQG 7 AV1S5 HPNKGLQLLLKYTSAATLVKG 8 AV2S1A1 YSGKSPELIMFIYSNGDKEDG 9 AV2S1A2 YSGKSPELIMSIYSNGDKEDG 10 AV2S2A1T YSRKGPELLMYTYSSGNKEDG 11 AV2S2A2T YSRIGPELLMYTYSSGNKEDG 12 AV2S3A1T DCRKEPKLLMSVYSSGNEDGR 13 AV3S1 NSGRGLVHLILIRSNEREKHS 14 AV4S1 LPSQGPEYVIHGLTSNVNNRM 15 AV4S2A1T IHSQGPQYIIHGLKNNETNEM 16 AV4S2A3T IHSQGPQNIIHGLKNNETNEM 17 AV5S1 DPGRGPVFLLLIRENEKEKRK 18 ADV6S1A1N1 SSGEMIFLIYQGSYDQQNATE 19 AV6S1A2N1 SSGEMIFLIYQGSYDEQNATE 20 AV7S1A1 HDGGAPTFLSYNALDGLEETG 21 AV7S1A2 HDGGAPTFLSYNGLDGLEETG 22 AV7S2 HAGEAPTFLSYNVLDGLEEKG 23 AV8S1A1 ELGKRPQLIIDIRSNVGEKKD 24 AV8S1A2 ELGKGPQLIIDIRSNVGEKKD 25 AV8S2A1N1T ESGKGPQFIIDIRSNMDKRQG 26 AV9S1 YSRQRLQLLLRHISRESIKGF 27 AV10S1A1 EPGEGPVLLVTVVTGGEVKKL 28 AV11S1A1T FPGCAPRLLVKGSKPSQQGRY 29 AV12S1 PPSGELVFLIRRNSFDEQNEI 30 AV13S1 NPWGQLINLFYIPSGTKQNGR 31 ADV14S1 PPSRQMILVIRQEAYKQQNAT 32 AV15S1 EPGAGLQLLTYIFSNMDMKQD 33 AV16S1A1T YPNRGLQFLLKYITGDNLVKG 34 ADV17S1A1T FPGKGPALLIAIRPDVSEKKE 35 AV18S1 ETAKTPEALFVMTLNGDEKKK 36 AV19S1 HPGGGIVSLFMLSSGKKKHGR 37 AV20S1 FPSQGPRFIIQGYKTKVTNEV 38 AV21S1A1N1 YPAEGPTFLISISSIKDKNED 39 AV22S1A1N1T YPGEGLQLLLKATKADDKGSN 40 AV23S1 DPGKGLTSLLLIQSSQREQTS 41 AV24S1 DTGRGPVSLTIMTFSENTKSN 42 AV25S1 DPGEGPVLLIALYKAGELTSN 43 AV26S1 KYGEGLIFLMMLQKGGEEKSH 44 AV27S1 DPGKSLESLFVLLSNGAVKQE 45 AV28S1A1T QEKKAPTFLFMLTSSGIEKKS 46 AV29S1A1T KHGEAPVFLMILLKGGEQMRR 47 AV29S1A2T KHGEAPVFLMILLKGGEQKGH 48 AV30S1A1T DPGKGPEFLFTLYSAGEEKEK 49 AV31S1 YPSKPLQLLQRETMENSKNFG 50 AV32S1 RPGGHPVFLIQLVKSGEVKKQ 51 [0125] [0125] TABLE 2 Name Amino Acid Sequence SEQ ID NO: BV1S1A1N1 SLDQGLQFLIQYYNGEERAKG 52 BV1S1A2 SLDQGLQFLIHYYNGEERAKG 53 BV2S1A1 FPKQSLMLMATSNEGSKATYE 54 BV2S1A3N1 FPKKSLMLMATSNEGSKATYE 55 BV2S1A4T FPKQSLMLMATSNEGCKATYE 56 BV2S1A5T FPKKSLMQIATSNEGSKATYE 57 BV3S1 DPGLGLRLIYFSYDVKMKEKG 58 BV4S1A1T QPGQSLTLIATANQGSEATYE 59 BV5S1A1T TPGQGLQFLFEYFSETQRNKG 60 BV5S1A2T TLGQGLQFLFEYFSETQRNKG 61 BV5S2 ALGQGPQFIFQYYEEEERQRG 62 BV5S3A1T VLGQGPQFIFQYYEKEERGRG 63 BV5S4A1T ALGLGLQLLLWYDEGEERNRG 64 BV5S4A2T ALGLGLQFLLWYDEGEERNRG 65 BV5S6A1T ALGQGPQFIFQYYREEENGRG 66 BV6S1A1N1 SLGQGPEFLIYFQGTGAADDS 67 BV6S1A3T SLGQGPELLIYFQGTGAADDS 68 BV6S2A1N1T ALGQGPEFLTYFQNEAQLDKS 69 BV6S3A1N1 ALGQGPEFLTYFNYEAQQDKS 70 BV6S4A1 TLGQGPEFLTYFQNEAQLEKS 71 BV6S4A4T NPGQGPEFLTYFQNEAQLEKS 72 BV6S5A1N1 SLGQGLEFLIYFQGNSAPDKS 73 BV6S6A1T ALGQGPEFLTYFNYEAQPDKS 74 BV6S8A2T TLGQGSEVLTYSQSDAQRDKS 75 BV7S1A1N1T KAKKPPELMFVYSYEKLSINE 76 BV7S2A1N1T SAKKPLELMFVYSLEERVENN 77 BV7S3A1T SAKKPLELMFVYNFKEQTENN 78 BV8S1 TMMRGLELLIYFNNNVPIDDS 79 BV8S3 TMMQGLELLAYFRNRAPLDDS 80 BV9S1A1T DSKKFLKIMFSYNNKELIINE 81 BV10S1P KLEEELKFLVYFQNEELIQKA 82 BV10S2O TLEEELKFFIYFQNEEIIQKA 83 BV11S1A1T DPGMELHLIHYSYGVNSTEKG 84 BV12S1A1N1 DPGHGLRLIHYSYGVKDTDKG 85 BV12S2A1T DLGHGLRLIHYSYGVQDTNKG 86 BV12S2A2T DLGHGLRLIHYSYGVKDTNKG 87 BV12S2A3T DLGHGLRLIHYSYGVHDTNKG 88 BV12S3 DLGHGLRLIYYSAAADITDKG 89 BV13S1 DPGMGLRLIHYSVGAGITDQG 90 BV13S2A1T DPGMGLRLIHYSVGEGTTAKG 91 BV13S3 DPGMGLRLIYYSASEGTTDKG 92 BV13S4 DPGMGLRRIHYSVAAGITDKG 93 BV13S5 DLGLGLRLIHYSNTAGTTGKG 94 BV13S6A1N1T DPGMGLKLIYYSVGAGITDKG 95 BV13S7 DPGMGLRLIYYSAAAGTTDKE 96 BV14S1 DPGLGLRQIYYSMNVEVTDKG 97 BV15S1 DPGLGLRLIYYSFDVKDINKG 98 BV16S1A1N1 VMGKEIKFLLHFVKESKQDES 99 BV17S1A1T DPGQGLRLIYYSQIVNDFQKG 100 BV17S1A2T DPGQGLRLIYYSHIVNDFQKG 101 BV18S1 LPEEGLKFMVYLQKENIIDES 102 BV19S1P NQNKEFMLLISFQNEQVLQET 103 BV19S2O NQNKEFMFLISFQNEQVLQEM 104 BV20S1A1N1 AAGRGLQLLFYSVGIGQISSE 105 BV20S1A1N3T AAGRGLQLLFYSIGIDQISSE 106 BV21S1 ILGQGPELLVQFQDESVVDDS 107 BV21S2A1N2T NLGQGPELLIRYENEEAVDDS 108 BV21S3A1T ILGQGPKLLIQFQNNGVVDDS 109 BV22S1A1T ILGQKVEFLVSFYNNEISEKS 110 BV23S1A1T GPGQDPQFFISFYEKMQSDKG 111 BV23S1A2T GPGQDPQFLISFYEKMQSDKG 112 BV24S1A1T KSSQAPKLLFHYYNKDFNNEA 113 BV24S1A2T KSSQAPKLLFHYYDKDFNNEA 114 BV25S1A1T VLKNEFKFLISFQNENVFDET 115 BV25S1A3T VLKNEFKFLVSFQNENVFDET 116 [0126] Detection of cytokine producing cells. PBMC were removed from plates by washing with 3× with PBS and 3× with PBS/0.05% Tween, pH 7.6. To each well was added 100 μl of either anti-IFN-γ (1 μg/ml, Mabtech) or anti-IL-10 (2 μg/ml, Pharmingen) and incubated for 4 hours at room temperature in the dark. Plates were washed 4× with PBS/Tween, then 100 μl per well of alkaline-phosphatase-conjugated streptaviden (DAKO) (1:1000 of stock) was added and plates were incubated for 45 minutes at room temperature. Plates were washed 4× with PBS/Tween and 6× with PBS, 1 minute each. 100 μl of BCIP/NBT substrate (KPL laboratories) was added and the color reaction was allowed to develop for 3-7 minutes. Plates were rinsed 3× with distilled water and dried overnight at room temperature. [0127] Analysis of ELISPOTS. Plates were scanned with an Immunospot Reader (Cellular Technology Limited) with optimized lighting conditions and analyzed according to the predetermined parameters of sensitivity, spot size, and background. The background counts were subtracted, and data was then normalized to cytokine secreting cells per million PBMC plated. [0128] Analysis of TCR gene expression. mRNA is obtained from T cells as described in Example I, and TCR gene expression is determined by RT PCR using the AV primers set forth in Table 3 and the BV primers set forth in Table 4. TABLE 3 Nucleotide Sequence SEQ Name (5′ to 3′) ID NO: AV1 GGCATTAACGGTTTTGAGGCTGGA 117 AV2 CAGTGTTCCAGAGGGAGCCATTGT 118 AV3 CCGGGCAGCAGACACTGCTTCTTA 119 AV4 TTGGTATCGACAGCTTCACTCCCA 120 AV5 CGGCCACCCTGACCTGCAACTATA 121 AV6 TCCGCCAACCTTGTCATCTCCGCT 122 AV7 GCAACATGCTGGCGGAGCACCCAC 123 AV8 CATTCGTTCAAATGTGGGCAAAAG 124 AV8.1 GTGAATGGAGAGAATGTGGAGC 125 AV8.2 TGAGCAGAGGAGAGAGTGTGG 126 AV9 CCAGTACTCCAGACAACGCCTGCA 127 AV10 CACTGCGGCCCAGCCTGGTGATAC 128 AV11 CGCTGCTCATCCTCCAGGTGCGGG 129 AV12 TCGTCGGAACTCTTTTGATGAGCA 130 AV13 TTCATCAAAACCCTTGGGGACAGC 131 AV14 CCCAGCAGGCAGATGATTCTCGTT 132 AV15 TTGCAGACACCGAGACTGGGGACT 133 AV16 TCAACGTTGCTGAAGGGAATCCTC 134 AV17 TGGGAAAGGCCGTGCATTATTGAT 135 AV18 CAGCACCAATTTCACCTGCAGCTT 136 AV19 ACACTGGCTGCAACAGCATCCAGG 137 AV20 TCCCTGTTTATCCCTGCCGACAGA 138 AV21 AGCAAAATTCACCATCCCTGAGCG 139 AV22 CCTGAAAGCCACGAAGGCTGATGA 140 AV23 TGCCTCGCTGGATAAATCATCAGG 141 AV24 CTGGATGCAGACACAAAGCAGAGC 142 AV25 TGGCTACGGTACAAGCCGGACCCT 143 AV26 AGCGCAGCCATGCAGGCATGTACC 144 AV27 AAGCCCGTCTCAGCACCCTCCACA 145 AV28 TGGTTGTGCACGAGCGAGACACTG 146 AV29 GAAGGGTGGAGAACAGATGCGTCG 147 AC (Sol'n.151) AGAGTCTCTCAGCTGGTACA 148 AC (HCA23) GTC TCT GAG CTG GTA CAG GG 149 AC (5′) GAACCCTGACCCTGCCGTGTACC 150 AC (3′) ATCATAAATTCGGGTAGGATCC 151 [0129] [0129] TABLE 4 SEQ ID Name Nucleotide Sequence (5′-3′) NO: BV1 GCA CAA CAG TTC CCT GAC TTG CAC 152 BV2 TCA TCA ACC ATG CAA GGG TGA CGT 153 BV3 GTC TCT AGA GAG AAG AAG GAG CGC 154 BV4 ACA TAT GAG AGT GGA TTT GTC ATT 155 BV5.1 ATA CTT CAG TGA GAG ACA GAG AAA C 156 BV5.2.3 TTC CCT AAC TAT AGC TCT GAG CTG 157 BV6.1.3 AGG CCT GAG GGA TCC GTC TC 158 BV7 CCT GAA TGC CCC AAC AGC TCT C 159 BV8 ATT TAG TTT AAC AAC AAC GTT CCG 160 BV9 CCT AAA TCT CCA GAC AAA GCT CAC 161 BV10 CTC CAA AAA CTC ATC CTG TAC CTT 162 BV11 TCA ACA GTC TCC AGA ATA AGG ACG 163 BV12 (B) ACT GAC AAA GGA GAA GTC TCA GAT 164 BV13.1 (B) CAC TGA CCA AGG AGA AGT CCC CAA T 165 BV13.2 (B) GTG AGT TGG TGA GGG TAC AAC TGC C 166 BV14 GTC TCT CGA AAA GAG AAG AGG AAT 167 BV15 AGT GTC TCT CGA CAG GCA CAG GCT 168 BV16 AAA GAG TCT AAA CAG GAT GAG TCC 169 BV17(B) CTA CTC ACA GAT AGT AAA TGA CTT 170 TCA G BV18 GAT GAG TCA GGA ATG CCA AAG GAA 171 BV19 CAA TGC CCC AAG AAC GCA CCC TGC 172 BV20 AGC TCT GAG GTG CCC CAG AAT CTC 173 BV21 (C) TGT GGC TTT TTG GTG CAA TCC TAT 174 BV22 GTT TTA TGA AAA GAT GCA GAG CGA 175 BV23 ATA ATG AAA TCT CAG AGA AGT CTG 176 BV24 GCA GAC ACC CCT GAT AAC TTC 177 BC (HCB-E) CGT AGA ATT CGA CTT GAC AGC GGA 178 AGT GGT BC (H3CB5) CTG CTT CTG ATG GCT CAA ACA C 179 BC (5′) CGCTGTCAAGTCCAGTTCTA 180 BC (3′) TCTCTTGACCATGGCCATCA 181 [0130] Treg assay: CD4+CD25+ and CD4+CD25− T cells were separated from 100 ml blood and each subpopulation was stimulated with anti-CD3+ anti-CD28 mAbs alone or in mixed cultures containing a fixed number (10,000) of CD4+CD25− responder cells and varying numbers of CD4+CD25+ T cells to give 0%, 20%, 33%, 50%, 67% and 100% in triplicate cultures (see FIG. 5). After 3 days, the cells were harvested and assessed for proliferation and cytokine production (IFN-γ and IL-10) in culture supernatants by ELISA. The endpoint of each Treg assay is to verify a dose-dependent inhibition of Th1 function and to calculate the percentage of CD4+CD25+ T cells that produces 50% inhibition (I 50 ) of each parameter (see FIG. 5). Example 2 Natural Recognition of TCR Determinants in Healthy Control Donors [0131] It has been shown that: 1) that peptides including CDR2 (residues 38-58 with a core epitope extending from residues 46-52) appear to be the most immunogenic region of both AV and BV proteins; 2) that injection of a modified (Y49T) BV5S2 peptide into MS patients can induce significantly increased frequencies of BV5S2-reactive T cells in about half of vaccinated patients, resulting in reduced response to MBP and a significant trend towards clinical benefit in patients with response to vaccination; 3) that TCR-specific T cells can be activated by target Th1 cells expressing the cognate TCR, presumably through expression of internally processed TCR chains associated with upregulated MHC Class II molecules, or by APC pulsed with the specific TCR peptide, but not by T cells expressing a different TCR; 4) that once activated by whole cells or specific peptides, the TCR-reactive T cells secrete soluble inhibitory factors, including IL-10, that can inhibit activation and cytokine secretion both by target and bystander Th1 cell (see U.S. patent application Ser. No. 09/853,830; Vandenbark et al., J. Neurosci. Res. 66:171-176, 2001, which are herein incorporated by reference in their entirety). These mechanisms account for the broader effects of vaccination observed with BV5S2 peptide than would be predicted solely on the basis of BV5S2 expression by MBP-specific T cells, which occurs in <25% of MBP-reactive T cell clones. In addition, data suggest that native T cell responses to BV5S2 and other V genes normally present in healthy controls are deficient in about half of the MS patients (Vandenbark et al., J. Neurosci. Res. 66:171-176, 2001). [0132] To evaluate native recognition of TCR determinants, the frequency of IL-10 and IFN-γ-secreting T cells from the blood of 5 healthy controls (3 females, 2 males, average age 28) was assessed using the ELISPOT assay to detect responses to a comprehensive panel of 113 unique CDR2 peptides representing nearly all of the AV and BV repertoires (see FIGS. 8 and 9 of Ref. (101), included in Appendix, for actual sequences). Only 3 peptides, AV1S4A1N1T, BV15S1 and BV20S1A1N1 could not be tested due to solubility and toxicity problems. As is shown in FIG. 1 (BV) and FIG. 2 (AV), peptide-specific T cells secreting either IL-10 or IFN-γ were detected in response to nearly all of the TCR peptides tested. Frequencies varied considerably from peptide to peptide and from donor to donor, but overall were not markedly different between males and females. It is noteworthy that the average frequency of IL-10-secreting T cells recognizing BV peptides was >600 cells/million PBMC, and for AV peptides, >300 cells/million. The most reactive IL-10-inducing BV peptide (>2000 cells/million PBMC) was BV10S1P (FIG. 1), a pseudogene presumed not to be present as a functional TCR, whereas the most reactive AV peptide (>1000 cells/million PBMC) was a rare AV29S1A2T allele (FIG. 2). Interestingly, BV10S1P induced minimal frequencies of IFN-γ-secreting cells, suggesting a strongly biased Th2 response. IFN-γ responses to TCR peptides were less vigorous than IL-10 responses, with an average frequency of 250 cells/million BV-reactive T cells and an average frequency of 182 cells/million AV-reactive T cells. The most reactive IFN-γ-inducing peptide (900 cells/million PBMC) was BV19S1P, another pseudogene. The strong recognition of relatively rare TCR sequences suggests an inverse correlation between TCR expression and TCR peptide recognition that may implicate TCR-reactive T cells as regulators of TCR repertoire formation, although it is yet unknown if both IL-10- and IFN-γ-secreting T cells possess regulatory function. As is shown in Table 5, total frequencies of IL-1 O-secreting T cells were higher than those of IFN-γ-secreting T cells for all 5 donors, and in most cases frequencies to BV peptides were higher than to AV peptides. TABLE 5 IL-10 and IFN-γ Elispot frequencies to CDR2 peptides in Healthy Controls (Numbers of cells per million PBMC producing cytokine in response to the CDR2 peptides): HCl HC2 HC3 HC4 HC144 F M F F M Average age 25 age 37 age 25 age 23 age 29 of 5 HC SEM IL-10 AV CDR2 8293 7817 19557 17444 22239 15070 3314 Frequency IL-10 BV CDR2 26561 36729 53588 35529 40568 38595 4914 Frequency Total IL-10 34855 44546 73145 52973 62807 (AV + BV) CDR2 Frequency IFN-γ AV CDR2 9303 5091 20093 8878 2241 9121 3392 Frequency IFN-γ BV CDR2 8933 6428 24712 31637 6777 15697 5845 Frequency Total IFN-γ 18236 11519 44805 40515 9018 24818 8351 (AV + BV) CDR2 Frequency Total (AV + BV) 53091 56065 117950 93488 71825 78484 13635 Frequency [0133] [0133] TABLE 6 IL-10 and IFN-γ ELISPOT frequencies to CDR2 peptides in MS patients (Numbers of cells per million PBMC producing cytokine in response to the CDR2 peptides): MS193 (RR)* MS74 (RR)* MS186 (SP) Average of all F age 42 (A) F age 61 (A) M age 65 (A) MS Donors SEM IL-10 AV CDR2 11891 7904 4025* 7940 2781 Frequency IL-10 BV CDR2 28867 22183 2484 17845† 9699 Frequency Total IL-10 (AV + BV) 40758 30087 6509 25785 12392 CDR2 Frequency IFN-γ AV CDR2 1349 1296 12* 886 535 Frequency IFN-γ BV CDR2 853 1993 260 1035 623 Frequency Total IFN-γ 2203 3289 272 1921 1081 (AV + BV) CDR2 Frequency Total (AV + BV) 42961 33376 6781 27706† 13254 Frequency [0134] The total frequencies of TCR-reactive T cells, calculated by summing the individual frequencies, showed only a two-fold range of responses among the 5 HC donors. These data suggest that on average, as much as 8% of total circulating T cells (78,484 cells/million PBMC) were responsive to TCR CDR2 sequences (Table 5), although this figure is probably somewhat inflated when one considers cross-reactivity among TCR peptides, and T cell clones that secrete both IL-10 and IFN-γ in response to a single peptide. If indeed these TCR reactive T cells possess Treg activity, CDR2-reactive T cells would represent a substantial portion of the CD4+CD25+ Treg population in healthy controls that has been estimated to be between 5 and 10% of T cells. Example 3 Deficient TCR-Reactive T Cells in MS Patients [0135] It has been demonstrated that the frequencies of IL-10-secreting PBMC specific for CDR2 peptides from BV5S2 and BV6S1 were significantly lower in MS patients versus HC (FIG. 3). This analysis was expanded to the nearly complete panel of 113 AV and BV CDR2 peptides in 3 MS patients for comparison with the 5 HC presented above (FIGS. 1 and 2). The results show striking differences in both the magnitude and pattern of response in the MS patients versus healthy controls (HC). Note that the reduction in IL-10 responses to BV5 S2 and BV6S 1 peptides shown previously (FIG. 3) was again evident in the expanded analysis (FIG. 1). Overall, the total frequency of T cells responding to the panel of CDR2 peptides was significantly reduced (p=0.03) by 65% compared to HC (27,706 cells/million in MS versus 78,484 cells/million in HC, Tables 1 and 2). This reduction was especially marked (>90%) in the frequencies of IFN-γ-secreting T cells in all three MS patients, but was also evident in IL-10-secreting T cells (>50% decrease versus HC), with a significant reduction (p=0.045) in response to BV peptides (17,845 cells/million in MS versus 38,595 cells/million in HC). Moreover, the pattern of response was clearly different in MS patients, showing overall reduced frequencies to most peptides (one example is shown in FIG. 4A). However, for a few peptides, the MS patients responded better than HC. [0136] For example, the two symptomatic RRMS patients, MS 193 and MS74, were very reactive to AV1S2A1N1T (>1700 cells/million), whereas there was essentially no response in HC (<25 cells/million) (FIG. 4B). In combination, this group of eight peptides was recognized significantly better by these two MS patients than HC (p<0.03, FIG. 4B). The third SPMS patient (MS186), although having an overall response of only 6% versus HC, nonetheless had an increased response to BV25S1A1T (450 cells/million versus 150 cells/million in HC) and AV1S2A1N1T (300 cells/million versus <25 cells/million in HC, not shown). The AV29S1A2T peptide was highly reactive in MS patients (>1500 cells/million) and HC (about 1000 cells/million) (FIG. 2), as were the BV5S4A1T and BV5S4A2T alleles (>1000 cells/million in both MS patients and HC) (FIG. 1) that likely were cross-reactive (only an F for L difference at residue 8). Surprisingly, however, the MS patients responded poorly to the pseudogene peptides, BV10S1P and BV19S1P (FIG. 1). Taken together, these unique data demonstrate a broad deficiency of TCR reactive T cells, particularly those secreting IFN-γ, with a more profound deficit in the SPMS patient. Remarkably, there were strong perturbations in IL-10 responses to selected TCR peptides, especially in the symptomatic RRMS patients. These perturbations conceivably could reflect natural T-T interactions that occurred subsequent to the activation of a subset of pathogenic T cells that induced the relapses (e.g. BV5S4, BV7S 1 and AV 1 S2). It will now be of utmost importance to determine if elevated IL-10 responses to these peptides persist and ultimately limit the pathogenic response to bring about a state of remission. One might pre-suppose that vaccination with selected TCR peptides could amplify deficient TCR responses prior to relapses and thereby prevent or reduce activation of pathogenic T cells. If Treg activity is mediated in part by TCR-reactive T cells, as stated in our hypothesis, then specific activation with TCR peptides may result in a broad non-specific regulation of Th1 effector cells through cell-cell contact or by secretion of soluble inhibitory factors. Example 4 Identification of a Subset of Discriminatory TCR Peptides that Reflect Deficient Anti-TCR Responses in MS Patients Versus HC [0137] To facilitate evaluations of additional MS patients and control donors, a subset of TCR peptides was identified that optimally discerned differences in IL-10 responses between HC and MS patients. Seven BV peptides and 1 AV peptide were found that individually were recognized significantly better by all of the HC than the MS patients (FIG. 4A). Further comparison revealed a total frequency of 8,351±1,134 IL-10 secreting T cells/million PBMC in the 5 HC versus 1,197±838 in MS patients. This difference was highly significant (p<0.001) and discriminating (a net difference of 7154 cells/million PBMC), even though the sampling of patients was very small. Thus, it is clear that use of the peptide subset both reflected and enhanced our ability to detect the general deficiency in TCR-reactive IL-10 secreting T cells in MS initially detected by the complete set of CDR2 peptides (p<0.001 for subset versus p=0.03 for complete set of peptides comparing total HC versus MS IL-10 frequencies). The limit of 1.96 standard deviations below the mean of the HC values, 6083 cells/million PBMC, represents the 95% confidence interval, below which responses can be identified that are significantly deficient in future patients tested individually with the peptide subset. [0138] Using a similar approach for analyzing IFN-γ responses to TCR peptides, only 2 BV peptides (BV12S2A1T and BV12S2A2T) and one AV peptide (ADV6S1A1N1) were found that induced IFN-γ-secreting T cells in all 5 HC but that were poorly recognized by MS patients. The two BV12S2 alleles were also quite similar to each other, with only one difference in sequence in CDR2 (A1=Q; A2=K at position 16), but they produced distinct responses in individual donors). Although differences in recognition of each individual IFN-γ-inducing peptide were not significant in HC versus MS donors, the difference in the total frequency (994±528 in HC versus 13±21 in MS) was significant (=0.021) and discriminating (a net difference of 981 cells/million). However, because of the large variation in response among HC, a lower limit to detect deficient responses was not established. Example 5 TCR-Reactive T Cells Possess Treg Activity [0139] A standard procedure was recently developed for assessing inhibitory activity of CD4+CD25+ Treg cells in vitro. This assay involves separation of CD4 + T cells from PBMC using magnetic beads (giving >95% purity), and further separation of CD25+versus CD25− T cells from the purified CD4 + T cells, giving >90% purity of the CD25+ T cells and >98% purity of the CD25− T cells. These cell populations are cultured alone or are mixed at varying ratios using a constant number of CD4+CD25− responder T cells, and stimulated with plate-bound anti-CD3+anti-CD28 mAbs for 3 days, and are then assessed for proliferation responses using 3 H-Tdy uptake. Consistent with previous studies in healthy controls, the CD4+CD25− T cells alone gave a robust response to stimulation, whereas the CD4+CD25+ T cells alone had a drastically reduced response to stimulation (FIG. 5A). Moreover, there was a dose-dependent inhibition of the response of CD4+CD25− responder cells in the presence of increasing percentages of CD4+CD25+ Treg cells. By plotting the percent CD4+CD25+ cells versus the percent inhibition, the I 50 value (% CD4+CD25+ Treg cells giving 50% inhibition of CD4+CD25− indicator cells) was calculated for one HC as 42% (FIG. 5A). The mean I 50 for 3 HC was 49±11%. Using the same protocol, it was found that CD4+CD25+ T cells from an MS patient not only responded fully to stimulation with anti-CD3+anti-CD28 mAbs (unlike CD4+CD25+ T cells from HC, which were unresponsive), but also were unable to inhibit responses of CD4+CD25− T cells (FIG. 5B). Although many more patients need to be evaluated, these results are the first to indicate that an MS patient lacks detectable Treg activity, in support of our hypothesis. [0140] Having worked out the assay for Treg activity, the inhibitory activity of a TCR-reactive T cell line specific for a recombinant single chain AV23/BV6S1 TCR molecule (7× stimulation over background) was then evaluated. This CD4+CD25+ TCR-reactive T cell line had a low response to anti-CD3/CD28 stimulation and suppressed autologous CD4+CD25− responder cells in a dose-dependent manner (I 50 =43% TCR-reactive T cells, FIG. 5C). These results clearly establish that TCR-reactive T cells possess Treg activity comparable to that found in CD4+CD25+ T cells from PBMC. Although additional experiments are needed, this is a key finding demonstrating that TCR-reactive T cells define a subset of Treg cells. It is noteworthy that the TCR-reactive T cell lines could be selected and expanded in IL-2, but in the Treg assay, these same cells failed to proliferate when stimulated with anti-CD3/CD28 mAbs, as reported for freshly isolated Treg cells. Without being bound by theory, this observation supports the idea that Treg cells can proliferate and expand in vivo to self antigens (i.e. TCR determinants), but attain inhibitory activity at some stage of maturation that precludes continued proliferation. Example 6 Ongoing TCR Vaccination Study in MS [0141] A new trial was initiated to evaluate immunological, clinical, and MRI changes in MS patients over a period of 6 months during vaccination with a cocktail of three TCR CDR2 peptides, (Y49T)BV5S2, BV6S5, and BV13 μl, corresponding to TCR V genes predominantly expressed by MBP-specific T cells. Overall, a total of 60 relapsing and secondary progressive MS patients were enrolled, and of these, 25 receive 4 weekly injections followed by 5 monthly injections of the cocktail i.d. in buffer, 25 receive 6 monthly injections of the peptide cocktail in Incomplete Freund's adjuvant (IFA), an oil-in-water emulsion that boosts antigenicity, and 10 receive 6 monthly injections of IFA alone. [0142] Analysis of proliferation and cytokine T cell frequencies of 20 of these patients revealed a robust T cell response to vaccination in approximately 60% of the patients (see FIG. 6). ELISPOT evaluations of IL-10 and IFN-γ frequencies in response to the full panel of 113 CDR2 peptides are performed, as well as an assay of Treg activity prior to vaccination in an additional 30 patients to provide a baseline for comparison with a post-vaccination evaluation. [0143] There is considerable evidence to indicate that T cell recognition of TCR determinants represents a powerful innate regulatory network that can inhibit activation of inflammatory T cells. The nature and outcome of such T-T interactions has been difficult to study in humans, due to the complexity and number of V gene sequences, and the difficulty in defining precise TCR determinants. As disclosed herein, TCR determinants from most of the known CDR2 are unusually immunogenic, triggering release of IL-10 and/or IFN-γ by T cells from healthy donors. However, these same TCR peptides produced very different patterns of responses in some MS patients, and their recognition was drastically reduced in others, suggesting a general inability to regulate Th1 cells expressing the cognate V genes. Interestingly, vaccination with TCR peptides boosts anti-TCR T cell responses in a subset of patients, resulting in reduced responses to neuroantigens and often stabilization or reversal of clinical deficits. Without being bound by theory, TCR reactive T cells define a subset of Treg cells that are deficient in MS patients. This is supported by data showing robust TCR-reactive T cells and Treg activity in HC, but greatly reduced TCR-reactivity and lack of Treg activity in the first MS patients tested. Example 7 Unmasking of TCR Vaccination Trial [0144] As described above, the ability of a cocktail of 3 TCR peptides (CDR2 sequences from BV5S2, BV6S5, and BV13S1) to induce proliferation and cytokine responses has been tested. The peptide cocktail is injected either in incomplete Freund's adjuvant (IFA) or saline, and another group of patients received saline/IFA alone. Based on the very robust T cell frequencies observed in a number of MS patients, the trial was unblinded to determine if responses fell into one or the other peptide treatment group. Among the 21 patients evaluated, 0/4 receiving saline/IFA alone, 1/8 receiving peptide/saline, but 9/9 receiving peptide/IFA had robust and highly significant responses to one or more peptides in the cocktail (p<0.001). [0145] These results demonstrated that the peptides in IFA were much more immunogenic than in saline, and allowed additional experiments to be designed to evaluate additional immunological parameters. Thus, in one embodiment, peptides in IFA are administered to a subject of interest to provide the maximum immunization. [0146] In addition, it was found that TCR-specific T cell lines selected from patients successfully vaccinated with our peptide cocktail have potent Treg activity, and that one patient with a strong TCR response by LDA also began to show Treg activity in PBMC (see below). Example 8 Treg Activity in PBMC and TCR-Specific T Cell Lines from MS Patients [0147] Data is described above from one MS patient who completely lacked Treg activity in PBMC, from one HC who had strong Treg activity, and from a T cell line specific for a single chain TCR (AV23/BV6) that also had strong Treg activity. Treg activity was also analyzed in two additional MS patients from a clinical trial. Patient MS-102 received saline/IFA alone (no peptide), and as expected had no proliferation activity in response to any of the 3 peptides in the vaccine (CDR2 peptides from BV5S2, BV6S5, and BV13S1). At the end of the study, Treg assay was performed (FIG. 7A). This assay demonstrated that the CD4+CD25+ subfraction not only responded strongly to stimulation with anti-CD3/CD28 (unlike HC donors whose CD4+CD25+ Treg cells had low proliferation response to anti-CD3/CD28), but also completely failed to inhibit the activation of the CD4+CD25− indicator cells. [0148] A second patient, MS-111, was selected who had maximal LDA responses to vaccination (see FIG. 6). At the end of the 24 week trial, a T cell line was selected that was specific for the cocktail of 3 injected peptides. This T cell line had superior inhibitory properties, producing 50% inhibition in vitro at a ratio of 1:40 Treg cells:CD4+CD25− indicator cells (I 50 =0.024, FIG. 7B). In comparison, PBMC from HC typically produce 50% inhibition at about a 1:1 ratio, ranging from 40-60% Treg cells in the mixed culture (the mean I 50 for 3 HC=49±11=1:1.04 ratio). For example, Treg activity in PBMC from a healthy control (see FIG. 5A) had an 150=42%=1:1.38 ratio of Treg cells to CD4+CD25− indicator cells, and a T cell line specific for scTCR produced about the same level of Treg activity (150=43%=1:1.32 ratio, FIG. 5C). In contrast, a Th 1 T cell line selected against Tetanus toxoid antigen did not have any detectable Treg activity. [0149] This data (FIG. 7B) is a demonstration that T cells specific for CDR2 peptides possess Treg activity. Interestingly, Treg activity assessed in PBMC from Patient MS-1111 at exit from the trial (at the same time the T cell line was selected) was nearly within the normal range (I 50 =77%=3.3:1 ratio of Treg:, FIG. 7C), indicating that successful TCR peptide vaccination is associated with Treg activity in vivo. Example 9 Selection of TCR Peptide-Specific T Cell Lines from HC Donors [0150] As described above, two different pools of peptides were identified of use for discriminating either IL-10 (see FIG. 4A) or IFN-γ responses (see above) between HC and MS patients. Furthermore, a pool of peptides were identified to induce proliferation responses in both HC and MS patients, which can be used to select T cell lines in order to evaluate Treg activity from un-vaccinated donors. These 3 pools of peptides were tested for their ability to induce proliferative responses in an HC donor (FIG. 8). As is shown in the FIG. 8, all 3 pools produced significant proliferation responses in early T cell lines from HC-27. These data confirm the ability of the peptide pools to stimulate TCR-reactive T cells in un-vaccinated donors. CD4+CD25+ T cells from the T cell line selected against Pool #1 from an HC had Treg activity (I 50 =3.4 ratio), demonstrating that TCR reactive T cells from HC also possess inhibitory properties. Example 10 Determination if TCR Reactive T Cells Define a Subset of CD4+CD25+ Treg Cells [0151] Treg activity induced by response to TCR determinants is tested in CD4+CD25+ and CD4+CD45RO+ versus other T cell subpopulations. Cytokines involved and requirement for cell-cell contact for suppression are evaluated. [0152] CD4+CD25+ can be separated from CD4+CD25− T cells from the blood of HC using magnetic beads. These two populations are tested for response to the discriminatory subset of eight IL-10-inducing and 3 IFN-γ-inducing peptides identified above. As shown in FIG. 5, CD4+CD25+ T cells obtained using magnetic beads possess strong inhibitory activity when mixed with CD4+CD25− T cells and then stimulated with anti-CD3/CD28 mAbs. [0153] Because of the relatively large number of cells needed, buffy coats are used. Each buffy coat contains cells from about 550 ml blood, yields about 800 million PBMC, of which 40% (320 million) are CD4 + T cells, and about 5% of these (15-20 million) are CD4+CD25+ T cells, with the remaining CD4 + T cells (about 300 million) being CD4+CD25−. For each experiment, the CD4+CD25+ T cells are tested for inhibitory Treg activity against anti-CD3/CD28 mAb stimulated CD4+CD25− T cells. This assay requires about 2 million CD4+CD25+ T cells from each donor. For each TCR peptide to be tested, three replicate wells containing 250,000 separated T cells are set up, in addition to 50,000 T cell depleted APCs (using anti-CD3-coated beads) in ELISPOT plates for assessment of IL-10 or IFN-γ-secreting T cells. For each cytokine to be tested, six wells receiving no peptide as a negative control are also included, and three wells receiving anti-CD3 mAb as a positive control. Thus, for each cytokine, 24 wells (6 million CD4+CD25+ and 6 million CD4+CD25− T cells) are needed. A parallel assay is carried out using unseparated cells to determine what level of Treg reactivity is present initially. A similar approach is used to separate CD4+CD45RO+ versus CD4+CD45RO− T cells prior to ELISPOT testing for response to the selected panel of highly reactive TCR peptides to determine if TCR reactive T cells reside mainly in the naive (CD45RO-) or memory (CD45RO+) populations. Example 11 Determination if MS Patients with Deficient TCR Reactivity also have Deficient Treg Activity [0154] As disclosed herein, strikingly altered or deficient IL-10 responses to TCR peptides were found with a significantly reduced frequency of TCR-reactive IFN-γ-producing T cells in all 3 MS patients tested. Currently, it is unknown if MS patients with deficient TCR-reactivity also have reduced Treg activity, but this is expected if TCR-reactive T cells constitute a significant portion of the Treg cells. Thus, both TCR and Treg activity in MS patients and HC from the same sampling of blood is compared directly. [0155] For TCR recognition, IL-10 and IFN-γ ELISPOT assays using the subset of 8 discriminatory IL-10-inducing peptides identified above (FIG. 4A) and 3 IFN-γ-inducing peptides (ADV6S1A1N1, BV12S2A1T and BV12S2A2T) is carried out that optimally reflect deficient responses in MS patients. The assay utilizes triplicate cultures of 250,000 PBMC/well for each peptide and negative (medium) and positive (ConA) controls (about 18 million PBMC). Responses are quantified by determining the frequency of TCR reactive T cells above background for each peptide. For each HC or MS donor, the total IL-10 and IFN-γ frequencies are determined separately and compared for the two groups. Total IL-10 frequencies<6083 cells/million for the subset of peptides is considered a significantly reduced response, as determined above. [0156] For the Treg assay, CD4+CD25+ and CD4+CD25− T cells are separated from 100 ml blood and each subpopulation is stimulated with anti-CD3+anti-CD28 mAbs alone or in mixed cultures containing a fixed number (10,000) of CD4+CD25-responder cells and varying numbers of CD4+CD25+ T cells to give 0%, 20%, 33%, 50%, 67% and 100% in triplicate cultures (see FIG. 5). After 3 days, the cells are harvested and assessed for proliferation and cytokine production (IFN-γ and IL-13) in culture supernatants by ELISA. The endpoint of each Treg assay is to verify a dose-dependent inhibition of Th1 function and to calculate the percentage of CD4+CD25+T cells that produces 50% inhibition (I 50 ) of each parameter (see FIG. 5). [0157] As disclosed herein, Treg activity was demonstrated in 3 HC that was lacking in one MS patient. Thus, simultaneous TCR and Treg assays on ten RRMS patients (not on disease modifying agents) and ten age and gender matched HC are carried out. MS patients have decreased ELISPOT responses to the set of discriminatory peptides selected, and it is determined if this decreased TCR response correlates with decreased Treg activity compared to HC. [0158] It is necessary to test only a subset of the CDR2 peptides for this comparison in order to use available numbers of PBMC. Practically, blood donations are limited to about 120 ml, and the small percentage of CD4+CD25+ T cells in blood requires at least 100 ml of blood for the Treg assay, leaving only about 20 ml for the ELISPOT assay. Although the MS patients may react strongly to a few different peptides that are not tested, the subset used is generally representative of peptides that are recognized differently by MS versus HC, and taken together, these peptides should detect and quantify deficient TCR reactivity. Example 12 Evaluation of Treg Activity in Subjects with Multiple Sclerosis [0159] An evaluation of Treg responses in a total of 33 MS patients and 26 healthy control (HC) donors was carried out. For this study, blood was obtained by venipuncture from twenty-six HC donors (9 males and 17 females) and 33 MS patients (12 males and 21 females) after obtaining informed consent. The HC subjects had a mean age of 34 years (range, 22 to 60 years), and the MS patients had a mean age of 39 years (range, 20 to 61 years). [0160] Blood was collected into heparinized tubes and mononuclear cells separated by Ficoll density centrifugation. The indicator (CD4+CD25−) and suppressor (CD4+CD25+) cells were isolated from 100 million PBMC. These cells were first incubated for 45 minutes at 4° C. with anti-CD8, anti-CD19, anti-CD56, and anti-CD11b mAbs (Caltag, Burlingame, Calif.), at the following concentration: (# of PBMC×percent of CD8+ T cells, B cells, NK cells and Macrophages×4 ul). After washing twice the cells were incubated for another 45 minutes with 400 ul of magnetic beads (Dynal, Oslo, Norway) at 4° C. After placing on the magnet for two minutes, the negatively selected CD4 + T cells were collected and 25 ul of anti-CD25 mAb (Caltag, Burlingame, Calif.) was added. After a 45 minute incubation at 4° C. the cells were washed and 50 ul of magnetic beads added and incubated at 4° C. for another 45 minutes. The CD4+CD25− fraction was collected by placing the tube on the magnet and removing the supernatant. The CD4+CD25+ T cell fraction was removed from the magnetic beads by vortexing for two minutes and then placing the tube back on the magnet. A similar procedure was used for sorting CD45RO+ versus CD45RO− T cells from the CD4+CD25− fraction obtained above, using anti-CD45RO mAb (Caltag). [0161] Suppression assays were performed in 96-well round bottom plates (Becton Dickinson, Franklin Lakes, N.J.) in a final volume of 200 μl/well of 1% type AB human Serum complete media (Biowhittaker, Walkersville, Md.). Prior to assay setup the 96 well plates were incubated with 0.2 μg/well of anti-CD3 and anti-CD28 antibodies (Caltag Labs, Burlingame, Calif.) overnight at 4° C. All wells were washed before assay setup. The CD4+CD25− cells were plated at 2.0×10 4 /well alone or in combination with CD4+CD25+ cells in triplicates at 1.0×10 4 , 2.0×10 4 , and 4.0×10 4 /well. Thus the cells were co-cultured at ratios of: 1:0, 1:0.5, 1:1, 1:2, and 0:1. On day 6, 0.5 μCi of 3 H-thymidine (NEN, Boston, Mass.) was added to each well for the final 16 hours of culture. The cells were then harvested on glass fiber filters and assessed for uptake of the labeled thymidine by liquid scintillation. Percent suppression was determined at each mixed cell ratio compared to responses of CD4+CD25+ (suppressor cells) and CD4+CD25− T cells (indicator T cells) alone as follows: [0162] Mean cpm (indicator cells) - mean cpm (mixed cell culture) mean cpm (indicator cells) - mean cpm (suppressor cells) [0163] The percent suppression was plotted versus increasing percentage of suppressor:indicator cells and a regression line was calculated. I 50 values were determined as the ratio of suppressor:indicator cells that produced 50% suppression. In some instances, the data were presented only for the 1:2 ratio of indicator:suppressor cells. [0164] CD4+CD25+ T cells from younger HC donors were strongly inhibitory at a 1:2 ratio of indicator:regulatory T cells, but the inhibition declined with age. In contrast, CD4+CD25+ T cells from MS patients of all ages (tested concurrently with HC donors) had reduced or absent inhibitory activity versus autologous CD4+CD25− indicator cells. In total, Treg activity was detected in 12/26 HC donors versus 3/33 MS patients (p<0.002, Fisher's exact test). In donors under the age of 32, Treg responses were detected in 10/16 HC donors versus 1/13 MS patients (p<0.006). Treg activity was not detectable in 5 treatment-naive donors or in 18 of 19 MS patients receiving standard therapies, including IFN-β-1a (Avonex or Rebif), IFN-β-1b (Betaseron), or Glutiramer Acetate (GA). The one moderately suppressive MS patient in this category was receiving Avonex. This lack of suppressive Treg activity in the CD4+CD25+ T cell fraction was consistent upon retesting in four of the non-suppressive MS donors (indicated by error bars in FIG. 9). Additionally, no Treg activity was found in four MS patients from a recent TCR peptide vaccination trial who received placebo (IFA/saline) or a weak formulation of a trivalent TCR peptide vaccine in saline. However, two out of four MS patients from this trial who had been successfully vaccinated with the more potent formulation of the TCR peptide vaccine given in IFA did have detectable suppressive activity (FIG. 9). [0165] To verify that the lack of suppression by MS CD4+CD25+ T cells was not due to the method used to obtain the T cells, FACS-sorted CD4+CD25+ hi T cells were also used. These cells are known to possess the greatest suppressive activity, to inhibit FACS-sorted CD4+CD25− indicator cells. [0166] Briefly, PBMCs were isolated from peripheral blood by Ficoll (Amersham Phrmacia Biotech AB, Uppsala, Sweden) density gradient centrifugation. The indicator (CD4+CD25−) and suppressor (CD4+CD25+ high or low ) cell fractions were isolated from 150×10 6 PBMC. These cell fractions were sorted using a FACS Vantage (Becton Dickinson Biosciences, San Jose, Calif.). One hundred fifty million PBMCs were incubated with 0.4 ml each anti-CD4 FITC and anti-CD25PE (BD Pharmingen, San Diego, Calif.) for 20 minutes at 4° C. On the forward versus side scatter plot the sort regions were constrained to the lymphocyte population. Sorted cells were collected into serum containing medium, washed, and assessed for Treg activity under the same conditions as for magnetic bead sorted cells. [0167] For the Treg suppression assays (see FIG. 10), prior to assay setup, wells from a 96-well round bottom plate were coated with 0.05 ug/well of anti-CD3 overnight at 4° C. All wells were washed before assay setup. The CD4+CD25− cells were plated at 3.0×10 4 cells/well. While the CD4+CD25+ low or high cell fractions were plated in triplicates at 1.5×10 4 , 3.0×10 4 , and 6.0×10 4 cells/well. Thus the cells fractions were co-cultured at ratios of: 1:0, 1:0.5, 1:1, 1:2, and 0:1. Irradiated PBMCs were added to all wells as APC at 3×10 5 /well. Proliferation responses were assessed as described for the bead sorted suppression assay above. MS donors without suppressive activity using magnetic bead sorted cells also did not have detectable suppressive activity using FACS-sorted cells. Example 13 Treg Activity in T Cell Lines [0168] Treg activity was found in CD4+CD25+ T cells from 11 of 12 T cell lines specific for a variety of CDR2 peptides, with I 50 values ranging from 28% to 92%, whereas no Treg activity was found in 7 T cell lines specific for recall or myelin antigens (FIG. 11). Treg activity observed in the TCR-reactive T cell lines was also cell-cell contact dependent, and reversed completely by addition of IL-2 and antibodies to CTLA-4, GITR, IL-10, and IL-17, but not TGF-β, indicating that the T line cells possessed Treg characteristics identical to PBMC Treg cells. These results establish that CD4+CD25+ TCR-reactive T cells but not other CD4+CD25+ T cells possess Treg activity comparable to that found in CD4+CD25+ T cells from PBMC. [0169] It will be apparent that the precise details of the methods or compositions described may be varied or modified without departing from the spirit of the described invention. We claim all such modifications and variations that fall within the scope and spirit of the claims below. 1 181 1 21 PRT Artificial sequence synthetic 1 Tyr Pro Gly Gln His Leu Gln Leu Leu Leu Lys Tyr Phe Ser Gly Asp 1 5 10 15 Pro Leu Val Lys Gly 20 2 21 PRT Artificial sequence synthetic 2 Tyr Pro Asn Gln Gly Leu Gln Leu Leu Leu Lys Tyr Thr Ser Ala Ala 1 5 10 15 Thr Leu Val Lys Gly 20 3 21 PRT Artificial sequence synthetic 3 Tyr Pro Asn Gln Gly Leu Gln Leu Leu Leu Lys Tyr Thr Thr Gly Ala 1 5 10 15 Thr Leu Val Lys Gly 20 4 21 PRT Artificial sequence synthetic 4 Tyr Pro Asn Gln Gly Leu Gln Leu Leu Leu Lys Tyr Thr Ser Ala Ala 1 5 10 15 Thr Leu Val Lys Gly 20 5 21 PRT Artificial sequence synthetic 5 Tyr Pro Asn Gln Gly Leu Gln Leu Leu Leu Lys Tyr Leu Ser Gly Ser 1 5 10 15 Thr Leu Val Glu Ser 20 6 21 PRT Artificial sequence synthetic 6 Tyr Pro Asn Gln Gly Leu Gln Leu Leu Leu Lys Tyr Leu Ser Gly Ser 1 5 10 15 Thr Leu Val Lys Gly 20 7 21 PRT Artificial sequence synthetic 7 Ser Pro Gly Gln Gly Leu Gln Leu Leu Leu Lys Tyr Phe Ser Gly Asp 1 5 10 15 Thr Leu Val Gln Gly 20 8 21 PRT Artificial sequence synthetic 8 His Pro Asn Lys Gly Leu Gln Leu Leu Leu Lys Tyr Thr Ser Ala Ala 1 5 10 15 Thr Leu Val Lys Gly 20 9 21 PRT Artificial sequence synthetic 9 Tyr Ser Gly Lys Ser Pro Glu Leu Ile Met Phe Ile Tyr Ser Asn Gly 1 5 10 15 Asp Lys Glu Asp Gly 20 10 21 PRT Artificial sequence synthetic 10 Tyr Ser Gly Lys Ser Pro Glu Leu Ile Met Ser Ile Tyr Ser Asn Gly 1 5 10 15 Asp Lys Glu Asp Gly 20 11 21 PRT Artificial sequence synthetic 11 Tyr Ser Arg Lys Gly Pro Glu Leu Leu Met Tyr Thr Tyr Ser Ser Gly 1 5 10 15 Asn Lys Glu Asp Gly 20 12 21 PRT Artificial sequence synthetic 12 Tyr Ser Arg Ile Gly Pro Glu Leu Leu Met Tyr Thr Tyr Ser Ser Gly 1 5 10 15 Asn Lys Glu Asp Gly 20 13 21 PRT Artificial sequence synthetic 13 Asp Cys Arg Lys Glu Pro Lys Leu Leu Met Ser Val Tyr Ser Ser Gly 1 5 10 15 Asn Glu Asp Gly Arg 20 14 21 PRT Artificial sequence synthetic 14 Asn Ser Gly Arg Gly Leu Val His Leu Ile Leu Ile Arg Ser Asn Glu 1 5 10 15 Arg Glu Lys His Ser 20 15 21 PRT Artificial sequence synthetic 15 Leu Pro Ser Gln Gly Pro Glu Tyr Val Ile His Gly Leu Thr Ser Asn 1 5 10 15 Val Asn Asn Arg Met 20 16 21 PRT Artificial sequence synthetic 16 Ile His Ser Gln Gly Pro Gln Tyr Ile Ile His Gly Leu Lys Asn Asn 1 5 10 15 Glu Thr Asn Glu Met 20 17 21 PRT Artificial sequence synthetic 17 Ile His Ser Gln Gly Pro Gln Asn Ile Ile His Gly Leu Lys Asn Asn 1 5 10 15 Glu Thr Asn Glu Met 20 18 21 PRT Artificial sequence synthetic 18 Asp Pro Gly Arg Gly Pro Val Phe Leu Leu Leu Ile Arg Glu Asn Glu 1 5 10 15 Lys Glu Lys Arg Lys 20 19 21 PRT Artificial sequence synthetic 19 Ser Ser Gly Glu Met Ile Phe Leu Ile Tyr Gln Gly Ser Tyr Asp Gln 1 5 10 15 Gln Asn Ala Thr Glu 20 20 21 PRT Artificial sequence synthetic 20 Ser Ser Gly Glu Met Ile Phe Leu Ile Tyr Gln Gly Ser Tyr Asp Glu 1 5 10 15 Gln Asn Ala Thr Glu 20 21 21 PRT Artificial sequence synthetic 21 His Asp Gly Gly Ala Pro Thr Phe Leu Ser Tyr Asn Ala Leu Asp Gly 1 5 10 15 Leu Glu Glu Thr Gly 20 22 21 PRT Artificial sequence synthetic 22 His Asp Gly Gly Ala Pro Thr Phe Leu Ser Tyr Asn Gly Leu Asp Gly 1 5 10 15 Leu Glu Glu Thr Gly 20 23 21 PRT Artificial sequence synthetic 23 His Ala Gly Glu Ala Pro Thr Phe Leu Ser Tyr Asn Val Leu Asp Gly 1 5 10 15 Leu Glu Glu Lys Gly 20 24 21 PRT Artificial sequence synthetic 24 Glu Leu Gly Lys Arg Pro Gln Leu Ile Ile Asp Ile Arg Ser Asn Val 1 5 10 15 Gly Glu Lys Lys Asp 20 25 21 PRT Artificial sequence synthetic 25 Glu Leu Gly Lys Gly Pro Gln Leu Ile Ile Asp Ile Arg Ser Asn Val 1 5 10 15 Gly Glu Lys Lys Asp 20 26 21 PRT Artificial sequence synthetic 26 Glu Ser Gly Lys Gly Pro Gln Phe Ile Ile Asp Ile Arg Ser Asn Met 1 5 10 15 Asp Lys Arg Gln Gly 20 27 21 PRT Artificial sequence synthetic 27 Tyr Ser Arg Gln Arg Leu Gln Leu Leu Leu Arg His Ile Ser Arg Glu 1 5 10 15 Ser Ile Lys Gly Phe 20 28 21 PRT Artificial sequence synthetic 28 Glu Pro Gly Glu Gly Pro Val Leu Leu Val Thr Val Val Thr Gly Gly 1 5 10 15 Glu Val Lys Lys Leu 20 29 21 PRT Artificial sequence synthetic 29 Phe Pro Gly Cys Ala Pro Arg Leu Leu Val Lys Gly Ser Lys Pro Ser 1 5 10 15 Gln Gln Gly Arg Tyr 20 30 21 PRT Artificial sequence synthetic 30 Pro Pro Ser Gly Glu Leu Val Phe Leu Ile Arg Arg Asn Ser Phe Asp 1 5 10 15 Glu Gln Asn Glu Ile 20 31 21 PRT Artificial sequence synthetic 31 Asn Pro Trp Gly Gln Leu Ile Asn Leu Phe Tyr Ile Pro Ser Gly Thr 1 5 10 15 Lys Gln Asn Gly Arg 20 32 21 PRT Artificial sequence synthetic 32 Pro Pro Ser Arg Gln Met Ile Leu Val Ile Arg Gln Glu Ala Tyr Lys 1 5 10 15 Gln Gln Asn Ala Thr 20 33 21 PRT Artificial sequence synthetic 33 Glu Pro Gly Ala Gly Leu Gln Leu Leu Thr Tyr Ile Phe Ser Asn Met 1 5 10 15 Asp Met Lys Gln Asp 20 34 21 PRT Artificial sequence synthetic 34 Tyr Pro Asn Arg Gly Leu Gln Phe Leu Leu Lys Tyr Ile Thr Gly Asp 1 5 10 15 Asn Leu Val Lys Gly 20 35 21 PRT Artificial sequence synthetic 35 Phe Pro Gly Lys Gly Pro Ala Leu Leu Ile Ala Ile Arg Pro Asp Val 1 5 10 15 Ser Glu Lys Lys Glu 20 36 21 PRT Artificial sequence synthetic 36 Glu Thr Ala Lys Thr Pro Glu Ala Leu Phe Val Met Thr Leu Asn Gly 1 5 10 15 Asp Glu Lys Lys Lys 20 37 21 PRT Artificial sequence synthetic 37 His Pro Gly Gly Gly Ile Val Ser Leu Phe Met Leu Ser Ser Gly Lys 1 5 10 15 Lys Lys His Gly Arg 20 38 21 PRT Artificial sequence synthetic 38 Phe Pro Ser Gln Gly Pro Arg Phe Ile Ile Gln Gly Tyr Lys Thr Lys 1 5 10 15 Val Thr Asn Glu Val 20 39 21 PRT Artificial sequence synthetic 39 Tyr Pro Ala Glu Gly Pro Thr Phe Leu Ile Ser Ile Ser Ser Ile Lys 1 5 10 15 Asp Lys Asn Glu Asp 20 40 21 PRT Artificial sequence synthetic 40 Tyr Pro Gly Glu Gly Leu Gln Leu Leu Leu Lys Ala Thr Lys Ala Asp 1 5 10 15 Asp Lys Gly Ser Asn 20 41 21 PRT Artificial sequence synthetic 41 Asp Pro Gly Lys Gly Leu Thr Ser Leu Leu Leu Ile Gln Ser Ser Gln 1 5 10 15 Arg Glu Gln Thr Ser 20 42 21 PRT Artificial sequence synthetic 42 Asp Thr Gly Arg Gly Pro Val Ser Leu Thr Ile Met Thr Phe Ser Glu 1 5 10 15 Asn Thr Lys Ser Asn 20 43 21 PRT Artificial sequence synthetic 43 Asp Pro Gly Glu Gly Pro Val Leu Leu Ile Ala Leu Tyr Lys Ala Gly 1 5 10 15 Glu Leu Thr Ser Asn 20 44 21 PRT Artificial sequence synthetic 44 Lys Tyr Gly Glu Gly Leu Ile Phe Leu Met Met Leu Gln Lys Gly Gly 1 5 10 15 Glu Glu Lys Ser His 20 45 21 PRT Artificial sequence synthetic 45 Asp Pro Gly Lys Ser Leu Glu Ser Leu Phe Val Leu Leu Ser Asn Gly 1 5 10 15 Ala Val Lys Gln Glu 20 46 21 PRT Artificial sequence synthetic 46 Gln Glu Lys Lys Ala Pro Thr Phe Leu Phe Met Leu Thr Ser Ser Gly 1 5 10 15 Ile Glu Lys Lys Ser 20 47 21 PRT Artificial sequence synthetic 47 Lys His Gly Glu Ala Pro Val Phe Leu Met Ile Leu Leu Lys Gly Gly 1 5 10 15 Glu Gln Met Arg Arg 20 48 21 PRT Artificial sequence synthetic 48 Lys His Gly Glu Ala Pro Val Phe Leu Met Ile Leu Leu Lys Gly Gly 1 5 10 15 Glu Gln Lys Gly His 20 49 21 PRT Artificial sequence synthetic 49 Asp Pro Gly Lys Gly Pro Glu Phe Leu Phe Thr Leu Tyr Ser Ala Gly 1 5 10 15 Glu Glu Lys Glu Lys 20 50 21 PRT Artificial sequence synthetic 50 Tyr Pro Ser Lys Pro Leu Gln Leu Leu Gln Arg Glu Thr Met Glu Asn 1 5 10 15 Ser Lys Asn Phe Gly 20 51 21 PRT Artificial sequence synthetic 51 Arg Pro Gly Gly His Pro Val Phe Leu Ile Gln Leu Val Lys Ser Gly 1 5 10 15 Glu Val Lys Lys Gln 20 52 21 PRT Artificial sequence synthetic 52 Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile Gln Tyr Tyr Asn Gly Glu 1 5 10 15 Glu Arg Ala Lys Gly 20 53 21 PRT Artificial sequence synthetic 53 Ser Leu Asp Gln Gly Leu Gln Phe Leu Ile His Tyr Tyr Asn Gly Glu 1 5 10 15 Glu Arg Ala Lys Gly 20 54 21 PRT Artificial sequence synthetic 54 Phe Pro Lys Gln Ser Leu Met Leu Met Ala Thr Ser Asn Glu Gly Ser 1 5 10 15 Lys Ala Thr Tyr Glu 20 55 21 PRT Artificial sequence synthetic 55 Phe Pro Lys Lys Ser Leu Met Leu Met Ala Thr Ser Asn Glu Gly Ser 1 5 10 15 Lys Ala Thr Tyr Glu 20 56 21 PRT Artificial sequence synthetic 56 Phe Pro Lys Gln Ser Leu Met Leu Met Ala Thr Ser Asn Glu Gly Cys 1 5 10 15 Lys Ala Thr Tyr Glu 20 57 21 PRT Artificial sequence synthetic 57 Phe Pro Lys Lys Ser Leu Met Gln Ile Ala Thr Ser Asn Glu Gly Ser 1 5 10 15 Lys Ala Thr Tyr Glu 20 58 21 PRT Artificial sequence synthetic 58 Asp Pro Gly Leu Gly Leu Arg Leu Ile Tyr Phe Ser Tyr Asp Val Lys 1 5 10 15 Met Lys Glu Lys Gly 20 59 21 PRT Artificial sequence synthetic 59 Gln Pro Gly Gln Ser Leu Thr Leu Ile Ala Thr Ala Asn Gln Gly Ser 1 5 10 15 Glu Ala Thr Tyr Glu 20 60 21 PRT Artificial sequence synthetic 60 Thr Pro Gly Gln Gly Leu Gln Phe Leu Phe Glu Tyr Phe Ser Glu Thr 1 5 10 15 Gln Arg Asn Lys Gly 20 61 21 PRT Artificial sequence synthetic 61 Thr Leu Gly Gln Gly Leu Gln Phe Leu Phe Glu Tyr Phe Ser Glu Thr 1 5 10 15 Gln Arg Asn Lys Gly 20 62 21 PRT Artificial sequence synthetic 62 Ala Leu Gly Gln Gly Pro Gln Phe Ile Phe Gln Tyr Tyr Glu Glu Glu 1 5 10 15 Glu Arg Gln Arg Gly 20 63 21 PRT Artificial sequence synthetic 63 Val Leu Gly Gln Gly Pro Gln Phe Ile Phe Gln Tyr Tyr Glu Lys Glu 1 5 10 15 Glu Arg Gly Arg Gly 20 64 21 PRT Artificial sequence synthetic 64 Ala Leu Gly Leu Gly Leu Gln Leu Leu Leu Trp Tyr Asp Glu Gly Glu 1 5 10 15 Glu Arg Asn Arg Gly 20 65 21 PRT Artificial sequence synthetic 65 Ala Leu Gly Leu Gly Leu Gln Phe Leu Leu Trp Tyr Asp Glu Gly Glu 1 5 10 15 Glu Arg Asn Arg Gly 20 66 21 PRT Artificial sequence synthetic 66 Ala Leu Gly Gln Gly Pro Gln Phe Ile Phe Gln Tyr Tyr Arg Glu Glu 1 5 10 15 Glu Asn Gly Arg Gly 20 67 21 PRT Artificial sequence synthetic 67 Ser Leu Gly Gln Gly Pro Glu Phe Leu Ile Tyr Phe Gln Gly Thr Gly 1 5 10 15 Ala Ala Asp Asp Ser 20 68 21 PRT Artificial sequence synthetic 68 Ser Leu Gly Gln Gly Pro Glu Leu Leu Ile Tyr Phe Gln Gly Thr Gly 1 5 10 15 Ala Ala Asp Asp Ser 20 69 21 PRT Artificial sequence synthetic 69 Ala Leu Gly Gln Gly Pro Glu Phe Leu Thr Tyr Phe Gln Asn Glu Ala 1 5 10 15 Gln Leu Asp Lys Ser 20 70 21 PRT Artificial sequence synthetic 70 Ala Leu Gly Gln Gly Pro Glu Phe Leu Thr Tyr Phe Asn Tyr Glu Ala 1 5 10 15 Gln Gln Asp Lys Ser 20 71 21 PRT Artificial sequence synthetic 71 Thr Leu Gly Gln Gly Pro Glu Phe Leu Thr Tyr Phe Gln Asn Glu Ala 1 5 10 15 Gln Leu Glu Lys Ser 20 72 21 PRT Artificial sequence synthetic 72 Asn Pro Gly Gln Gly Pro Glu Phe Leu Thr Tyr Phe Gln Asn Glu Ala 1 5 10 15 Gln Leu Glu Lys Ser 20 73 21 PRT Artificial sequence synthetic 73 Ser Leu Gly Gln Gly Leu Glu Phe Leu Ile Tyr Phe Gln Gly Asn Ser 1 5 10 15 Ala Pro Asp Lys Ser 20 74 21 PRT Artificial sequence synthetic 74 Ala Leu Gly Gln Gly Pro Glu Phe Leu Thr Tyr Phe Asn Tyr Glu Ala 1 5 10 15 Gln Pro Asp Lys Ser 20 75 21 PRT Artificial sequence synthetic 75 Thr Leu Gly Gln Gly Ser Glu Val Leu Thr Tyr Ser Gln Ser Asp Ala 1 5 10 15 Gln Arg Asp Lys Ser 20 76 21 PRT Artificial sequence synthetic 76 Lys Ala Lys Lys Pro Pro Glu Leu Met Phe Val Tyr Ser Tyr Glu Lys 1 5 10 15 Leu Ser Ile Asn Glu 20 77 21 PRT Artificial sequence synthetic 77 Ser Ala Lys Lys Pro Leu Glu Leu Met Phe Val Tyr Ser Leu Glu Glu 1 5 10 15 Arg Val Glu Asn Asn 20 78 21 PRT Artificial sequence synthetic 78 Ser Ala Lys Lys Pro Leu Glu Leu Met Phe Val Tyr Asn Phe Lys Glu 1 5 10 15 Gln Thr Glu Asn Asn 20 79 21 PRT Artificial sequence synthetic 79 Thr Met Met Arg Gly Leu Glu Leu Leu Ile Tyr Phe Asn Asn Asn Val 1 5 10 15 Pro Ile Asp Asp Ser 20 80 21 PRT Artificial sequence synthetic 80 Thr Met Met Gln Gly Leu Glu Leu Leu Ala Tyr Phe Arg Asn Arg Ala 1 5 10 15 Pro Leu Asp Asp Ser 20 81 21 PRT Artificial sequence synthetic 81 Asp Ser Lys Lys Phe Leu Lys Ile Met Phe Ser Tyr Asn Asn Lys Glu 1 5 10 15 Leu Ile Ile Asn Glu 20 82 21 PRT Artificial sequence synthetic 82 Lys Leu Glu Glu Glu Leu Lys Phe Leu Val Tyr Phe Gln Asn Glu Glu 1 5 10 15 Leu Ile Gln Lys Ala 20 83 21 PRT Artificial sequence synthetic 83 Thr Leu Glu Glu Glu Leu Lys Phe Phe Ile Tyr Phe Gln Asn Glu Glu 1 5 10 15 Ile Ile Gln Lys Ala 20 84 21 PRT Artificial sequence synthetic 84 Asp Pro Gly Met Glu Leu His Leu Ile His Tyr Ser Tyr Gly Val Asn 1 5 10 15 Ser Thr Glu Lys Gly 20 85 21 PRT Artificial sequence synthetic 85 Asp Pro Gly His Gly Leu Arg Leu Ile His Tyr Ser Tyr Gly Val Lys 1 5 10 15 Asp Thr Asp Lys Gly 20 86 21 PRT Artificial sequence synthetic 86 Asp Leu Gly His Gly Leu Arg Leu Ile His Tyr Ser Tyr Gly Val Gln 1 5 10 15 Asp Thr Asn Lys Gly 20 87 21 PRT Artificial sequence synthetic 87 Asp Leu Gly His Gly Leu Arg Leu Ile His Tyr Ser Tyr Gly Val Lys 1 5 10 15 Asp Thr Asn Lys Gly 20 88 21 PRT Artificial sequence synthetic 88 Asp Leu Gly His Gly Leu Arg Leu Ile His Tyr Ser Tyr Gly Val His 1 5 10 15 Asp Thr Asn Lys Gly 20 89 21 PRT Artificial sequence synthetic 89 Asp Leu Gly His Gly Leu Arg Leu Ile Tyr Tyr Ser Ala Ala Ala Asp 1 5 10 15 Ile Thr Asp Lys Gly 20 90 21 PRT Artificial sequence synthetic 90 Asp Pro Gly Met Gly Leu Arg Leu Ile His Tyr Ser Val Gly Ala Gly 1 5 10 15 Ile Thr Asp Gln Gly 20 91 21 PRT Artificial sequence synthetic 91 Asp Pro Gly Met Gly Leu Arg Leu Ile His Tyr Ser Val Gly Glu Gly 1 5 10 15 Thr Thr Ala Lys Gly 20 92 21 PRT Artificial sequence synthetic 92 Asp Pro Gly Met Gly Leu Arg Leu Ile Tyr Tyr Ser Ala Ser Glu Gly 1 5 10 15 Thr Thr Asp Lys Gly 20 93 21 PRT Artificial sequence synthetic 93 Asp Pro Gly Met Gly Leu Arg Arg Ile His Tyr Ser Val Ala Ala Gly 1 5 10 15 Ile Thr Asp Lys Gly 20 94 21 PRT Artificial sequence synthetic 94 Asp Leu Gly Leu Gly Leu Arg Leu Ile His Tyr Ser Asn Thr Ala Gly 1 5 10 15 Thr Thr Gly Lys Gly 20 95 21 PRT Artificial sequence synthetic 95 Asp Pro Gly Met Gly Leu Lys Leu Ile Tyr Tyr Ser Val Gly Ala Gly 1 5 10 15 Ile Thr Asp Lys Gly 20 96 21 PRT Artificial sequence synthetic 96 Asp Pro Gly Met Gly Leu Arg Leu Ile Tyr Tyr Ser Ala Ala Ala Gly 1 5 10 15 Thr Thr Asp Lys Glu 20 97 21 PRT Artificial sequence synthetic 97 Asp Pro Gly Leu Gly Leu Arg Gln Ile Tyr Tyr Ser Met Asn Val Glu 1 5 10 15 Val Thr Asp Lys Gly 20 98 21 PRT Artificial sequence synthetic 98 Asp Pro Gly Leu Gly Leu Arg Leu Ile Tyr Tyr Ser Phe Asp Val Lys 1 5 10 15 Asp Ile Asn Lys Gly 20 99 21 PRT Artificial sequence synthetic 99 Val Met Gly Lys Glu Ile Lys Phe Leu Leu His Phe Val Lys Glu Ser 1 5 10 15 Lys Gln Asp Glu Ser 20 100 21 PRT Artificial sequence synthetic 100 Asp Pro Gly Gln Gly Leu Arg Leu Ile Tyr Tyr Ser Gln Ile Val Asn 1 5 10 15 Asp Phe Gln Lys Gly 20 101 21 PRT Artificial sequence synthetic 101 Asp Pro Gly Gln Gly Leu Arg Leu Ile Tyr Tyr Ser His Ile Val Asn 1 5 10 15 Asp Phe Gln Lys Gly 20 102 21 PRT Artificial sequence synthetic 102 Leu Pro Glu Glu Gly Leu Lys Phe Met Val Tyr Leu Gln Lys Glu Asn 1 5 10 15 Ile Ile Asp Glu Ser 20 103 21 PRT Artificial sequence synthetic 103 Asn Gln Asn Lys Glu Phe Met Leu Leu Ile Ser Phe Gln Asn Glu Gln 1 5 10 15 Val Leu Gln Glu Thr 20 104 21 PRT Artificial sequence synthetic 104 Asn Gln Asn Lys Glu Phe Met Phe Leu Ile Ser Phe Gln Asn Glu Gln 1 5 10 15 Val Leu Gln Glu Met 20 105 21 PRT Artificial sequence synthetic 105 Ala Ala Gly Arg Gly Leu Gln Leu Leu Phe Tyr Ser Val Gly Ile Gly 1 5 10 15 Gln Ile Ser Ser Glu 20 106 21 PRT Artificial sequence synthetic 106 Ala Ala Gly Arg Gly Leu Gln Leu Leu Phe Tyr Ser Ile Gly Ile Asp 1 5 10 15 Gln Ile Ser Ser Glu 20 107 21 PRT Artificial sequence synthetic 107 Ile Leu Gly Gln Gly Pro Glu Leu Leu Val Gln Phe Gln Asp Glu Ser 1 5 10 15 Val Val Asp Asp Ser 20 108 21 PRT Artificial sequence synthetic 108 Asn Leu Gly Gln Gly Pro Glu Leu Leu Ile Arg Tyr Glu Asn Glu Glu 1 5 10 15 Ala Val Asp Asp Ser 20 109 21 PRT Artificial sequence synthetic 109 Ile Leu Gly Gln Gly Pro Lys Leu Leu Ile Gln Phe Gln Asn Asn Gly 1 5 10 15 Val Val Asp Asp Ser 20 110 21 PRT Artificial sequence synthetic 110 Ile Leu Gly Gln Lys Val Glu Phe Leu Val Ser Phe Tyr Asn Asn Glu 1 5 10 15 Ile Ser Glu Lys Ser 20 111 21 PRT Artificial sequence synthetic 111 Gly Pro Gly Gln Asp Pro Gln Phe Phe Ile Ser Phe Tyr Glu Lys Met 1 5 10 15 Gln Ser Asp Lys Gly 20 112 21 PRT Artificial sequence synthetic 112 Gly Pro Gly Gln Asp Pro Gln Phe Leu Ile Ser Phe Tyr Glu Lys Met 1 5 10 15 Gln Ser Asp Lys Gly 20 113 21 PRT Artificial sequence synthetic 113 Lys Ser Ser Gln Ala Pro Lys Leu Leu Phe His Tyr Tyr Asn Lys Asp 1 5 10 15 Phe Asn Asn Glu Ala 20 114 21 PRT Artificial sequence synthetic 114 Lys Ser Ser Gln Ala Pro Lys Leu Leu Phe His Tyr Tyr Asp Lys Asp 1 5 10 15 Phe Asn Asn Glu Ala 20 115 21 PRT Artificial sequence synthetic 115 Val Leu Lys Asn Glu Phe Lys Phe Leu Ile Ser Phe Gln Asn Glu Asn 1 5 10 15 Val Phe Asp Glu Thr 20 116 21 PRT Artificial sequence synthetic 116 Val Leu Lys Asn Glu Phe Lys Phe Leu Val Ser Phe Gln Asn Glu Asn 1 5 10 15 Val Phe Asp Glu Thr 20 117 24 DNA Artificial sequence synthetic 117 ggcattaacg gttttgaggc tgga 24 118 24 DNA Artificial sequence synthetic 118 cagtgttcca gagggagcca ttgt 24 119 24 DNA Artificial sequence synthetic 119 ccgggcagca gacactgctt ctta 24 120 24 DNA Artificial sequence synthetic 120 ttggtatcga cagcttcact ccca 24 121 24 DNA Artificial sequence synthetic 121 cggccaccct gacctgcaac tata 24 122 24 DNA Artificial sequence synthetic 122 tccgccaacc ttgtcatctc cgct 24 123 24 DNA Artificial sequence synthetic 123 gcaacatgct ggcggagcac ccac 24 124 24 DNA Artificial sequence synthetic 124 cattcgttca aatgtgggca aaag 24 125 22 DNA Artificial sequence synthetic 125 gtgaatggag agaatgtgga gc 22 126 21 DNA Artificial sequence synthetic 126 tgagcagagg agagagtgtg g 21 127 24 DNA Artificial sequence synthetic 127 ccagtactcc agacaacgcc tgca 24 128 24 DNA Artificial sequence synthetic 128 cactgcggcc cagcctggtg atac 24 129 24 DNA Artificial sequence synthetic 129 cgctgctcat cctccaggtg cggg 24 130 24 DNA Artificial sequence synthetic 130 tcgtcggaac tcttttgatg agca 24 131 24 DNA Artificial sequence synthetic 131 ttcatcaaaa cccttgggga cagc 24 132 24 DNA Artificial sequence synthetic 132 cccagcaggc agatgattct cgtt 24 133 24 DNA Artificial sequence synthetic 133 ttgcagacac cgagactggg gact 24 134 24 DNA Artificial sequence synthetic 134 tcaacgttgc tgaagggaat cctc 24 135 24 DNA Artificial sequence synthetic 135 tgggaaaggc cgtgcattat tgat 24 136 24 DNA Artificial sequence synthetic 136 cagcaccaat ttcacctgca gctt 24 137 24 DNA Artificial sequence synthetic 137 acactggctg caacagcatc cagg 24 138 24 DNA Artificial sequence synthetic 138 tccctgttta tccctgccga caga 24 139 24 DNA Artificial sequence synthetic 139 agcaaaattc accatccctg agcg 24 140 24 DNA Artificial sequence synthetic 140 cctgaaagcc acgaaggctg atga 24 141 24 DNA Artificial sequence synthetic 141 tgcctcgctg gataaatcat cagg 24 142 24 DNA Artificial sequence synthetic 142 ctggatgcag acacaaagca gagc 24 143 24 DNA Artificial sequence synthetic 143 tggctacggt acaagccgga ccct 24 144 24 DNA Artificial sequence synthetic 144 agcgcagcca tgcaggcatg tacc 24 145 24 DNA Artificial sequence synthetic 145 aagcccgtct cagcaccctc caca 24 146 24 DNA Artificial sequence synthetic 146 tggttgtgca cgagcgagac actg 24 147 24 DNA Artificial sequence synthetic 147 gaagggtgga gaacagatgc gtcg 24 148 20 DNA Artificial sequence synthetic 148 agagtctctc agctggtaca 20 149 20 DNA Artificial sequence synthetic 149 gtctctcagc tggtacacgg 20 150 23 DNA Artificial sequence synthetic 150 gaaccctgac cctgccgtgt acc 23 151 22 DNA Artificial sequence synthetic 151 atcataaatt cgggtaggat cc 22 152 24 DNA Artificial sequence synthetic 152 gcacaacagt tccctgactt gcac 24 153 24 DNA Artificial sequence synthetic 153 tcatcaacca tgcaagcctg acct 24 154 24 DNA Artificial sequence synthetic 154 gtctctagag agaagaagga gcgc 24 155 24 DNA Artificial sequence synthetic 155 acatatgaga gtggatttgt catt 24 156 25 DNA Artificial sequence synthetic 156 atacttcagt gagacacaga gaaac 25 157 24 DNA Artificial sequence synthetic 157 ttccctaact atagctctga gctg 24 158 20 DNA Artificial sequence synthetic 158 aggcctgagg gatccgtctc 20 159 22 DNA Artificial sequence synthetic 159 cctgaatgcc ccaacagctc tc 22 160 24 DNA Artificial sequence synthetic 160 atttacttta acaacaacgt tccg 24 161 24 DNA Artificial sequence synthetic 161 cctaaatctc cagacaaagc tcac 24 162 24 DNA Artificial sequence synthetic 162 ctccaaaaac tcatcctgta cctt 24 163 24 DNA Artificial sequence synthetic 163 tcaacagtct ccagaataag gacg 24 164 24 DNA Artificial sequence synthetic 164 actgacaaag gagaagtctc agat 24 165 25 DNA Artificial sequence synthetic 165 cactgaccaa ggagaagtcc ccaat 25 166 25 DNA Artificial sequence synthetic 166 ctcagttggt gagggtacaa ctgcc 25 167 24 DNA Artificial sequence synthetic 167 gtctctcgaa aagagaagag gaat 24 168 24 DNA Artificial sequence synthetic 168 agtgtctctc gacaggcaca ggct 24 169 24 DNA Artificial sequence synthetic 169 aaagagtcta aacaggatga gtcc 24 170 28 DNA Artificial sequence synthetic 170 ctactcacag atagtaaatg actttcag 28 171 24 DNA Artificial sequence synthetic 171 gatgagtcag gaatgccaaa ggaa 24 172 24 DNA Artificial sequence synthetic 172 caatgcccca agaacgcacc ctgc 24 173 24 DNA Artificial sequence synthetic 173 agctctgagg tgccccagaa tctc 24 174 24 DNA Artificial sequence synthetic 174 tgtggctttt tggtgcaatc ctat 24 175 24 DNA Artificial sequence synthetic 175 gttttatgaa aagatgcaga gcga 24 176 24 DNA Artificial sequence synthetic 176 ataatgaaat ctcagagaag tctg 24 177 21 DNA Artificial sequence synthetic 177 gcagacaccc ctgataactt c 21 178 30 DNA Artificial sequence synthetic 178 cgtagaattc gacttgacag cggaagtggt 30 179 22 DNA Artificial sequence synthetic 179 ctgcttctga tggctcaaac ac 22 180 20 DNA Artificial sequence synthetic 180 cgctgtcaag tccagttcta 20 181 20 DNA Artificial sequence synthetic 181 tctcttgacc atggccatca 20

Description

Topics

Download Full PDF Version (Non-Commercial Use)

Patent Citations (24)

    Publication numberPublication dateAssigneeTitle
    US-2002183299-A1December 05, 2002The Regents Of The University Of CaliforniaEstriol therapy for multiple sclerosis and other autoimmune diseases
    US-5194425-AMarch 16, 1993Anergen, Inc.Mhc-mediated toxic conjugates useful in ameliorating autoimmunity
    US-5223426-AJune 29, 1993T Cell Sciences, Inc.Monoclonal antibodies reactive with defined regions of the t-cell antigen receptor
    US-5569585-AOctober 29, 1996Cellcor, Inc.In vitro assay measuring degree of activation of immune cells
    US-5612035-AMarch 18, 1997The Immune Response CorporationVaccination against diseases resulting from pathogenic responses by specific T cell populations
    US-5614192-AMarch 25, 1997Connective Therapeutics, Inc.T cell receptor peptides as therapeutics for immune-related disease
    US-5776459-AJuly 07, 1998Connetics CorporationTCR V beta 5 peptides
    US-5837246-ANovember 17, 1998The Immune Response CorporationVaccination and methods against diseases resulting from pathogenic responses by specific T cell populations
    US-5856446-AJanuary 05, 1999Autoimmune Inc.Method of treating rheumatoid arthritis with low dose type II collagen
    US-5858968-AJanuary 12, 1999Autoimmune Inc.Method of treating or preventing type 1 diabetes by oral administration of insulin
    US-5869093-AFebruary 09, 1999Autoimmune Inc.Treatment of immune diseases by oral administration of autoantigens
    US-5939281-AAugust 17, 1999Case Western Reserve UniversityDetecting alloreactivity
    US-5939400-AAugust 17, 1999The Board Of Trustees Of The Leland Stanford Junior UniversityDNA vaccination for induction of suppressive T cell response
    US-6019971-AFebruary 01, 2000Autoimmune Inc.Treatment of autoimmune arthritis by oral administration of collagen
    US-6039947-AMarch 21, 2000Autoimmune, Inc.Peptides derived from immunodominant epitopes of myelin basic protein
    US-6045796-AApril 04, 2000Anergen, Inc.Vaccination with peptide of MHC class II molecules for treatment of autoimmune disease
    US-6090387-AJuly 18, 2000The Immune Response CorporationVaccination and methods against diseases resulting from pathogenic responses
    US-6113903-ASeptember 05, 2000The Immune Response CorporationPeptides and methods against diabetes
    US-6159470-ADecember 12, 2000The Immune Response CorporationVaccination and methods against diseases resulting from pathogenic responses by specific T cell populations
    US-6197926-B1March 06, 2001Neurocrine BiosciencesMethods for treatment of diabetes using peptide analogues of insulin
    US-6207645-B1March 27, 2001The Immune Response CorporationVaccination and methods against diseases resulting from pathogenic responses by specific T cell populations
    US-6218132-B1April 17, 2001Anergen, Inc.Method for monitoring T cell reactivity
    US-6221352-B1April 24, 2001The Immune Response CorporationMethod of preventing the proliferation of Vβ14 or Vβ17-Expressing T cells
    US-6958327-B1October 25, 2005Schering, Ag18 Norsteroids as selectively active estrogens

NO-Patent Citations (0)

    Title

Cited By (3)

    Publication numberPublication dateAssigneeTitle
    US-2009010885-A1January 08, 2009Vandenbark Arthur A, Halina Offner, Richard BartholomewMethods for Detecting and Treating Autoimmune Disorders
    US-8053197-B2November 08, 2011Oregon Health & Science University, The United States Of America As Represented By The Department Of Veterans AffairsMethods for detecting and treating autoimmune disorders
    WO-2006012641-A3December 13, 2007Richard Bartholomew, Immune Response Corp Inc, Halina Offner, Univ Oregon Health & Science, Us Gov Veterans Affairs, Arthur A VandenbarkMethods for detecting and treating autoimmune disorders